Description :
From Genome Similarity Track
Location :
Scaffold_133:43856- 45939
Sequence
2083 bases(100 bases per row)
AGTCTGGGTGACTGCGTGTGGTACTGTGTTATCCACACAGGAAGCGCATTCAGCGCCTTCCTCTTCAGTTAAGGTCTGGGCGACCGTGTGGTCCTAAGTT
ACCCATCTGGTTAGCGCTTAAAGGCATAACCACTGTCGAAGCCCGTACGGCGCAACGACCTTCGGCGTTGGATGCTGCTGGTGTAGTAGGTTCACGCGCC
GGGCAAAAGACCCACGCCTGCGGCATTGCCGCAGCGGAGCATGGTCTTGCTGTACGCAGAGCTGTCGGTGCGTTGACAGCTCCGTGACGCTTCTGCGTCC
TGGCGGTCTGTATCAGACGCCCCAGTCATGACGGAGGTGGGAACATGACTCGCCAATGCTCCGTCATAGACCTGGACTGGTAGGCCCTTCTCAGCCTTGC
CCCACCAAAGTCCGGGCTGTGCCTTATGGTCGGCACAGCCATGTTGTTCATGGCGAGAACTGCGAGCGACACCGCGGTGCGCGAGTCCATCGAGCCGAAA
CGTTCAGGTCCGTTGAGGACCATTGGTACTTCCTTCACCGTACCAAAGGCTAGTCCACCAAGGACCAGCCCACGACCGCCACGCTGACATAGAGTGCAGT
CGGATGTCGCTATGCCAAGCGACGTTCCGGTGGCGTATCAACGCCCCAGAAGTCATCCAACGTTCAAGGGGTACCGTACCCCCGTACACCGAGTGTACTA
CCAGCAGCCCATCACTGCCCTTCACCGGTTTGAGAGAGCCACGTCTATCTGGGCTAAGTCCCGTGGTGCGCACAACCTGCACACCCATCACGAAGACTTA
GCGCTCTTCACTAGGGCATACTGCCTCTACTGGTGGCCGGGGAGTCTTCGTCCACCTGGCCGTGGCCTGCGCCACCGGACTTAGGGCCCACGAACCGTCT
TCCTTCCGAGGACTAGCGAGGGACACACACGCTGGTAGTGTCTATGTCCGCCGCATCCATTGCAGCGGACCAAGCTCTCGGCTGAGCTTAAGTCCATGGG
TTCGGGCTCGCTGTACGCACCGGTACCAACGAGCTGCGTGACAGCAGGAGCAACGGCGTCATTGCTGCGATGCTCCGCCTCCCGAGGAACGCCATTCTCA
TCGTGGCGATGTTCCTCTTCCCGAGGAGTACCAGCCTGCTTGTGGCTGTACTCTTCTTGAAGGGCGATTCGAATCGCCTCCTCCATAGTTGTCGCTTGCA
CCCGGAATAGCTGGGTGCGAGCAGGACCGACCTTCAGGCCGTCCATGAAGACTGTTGTCTTGACGTCTTCAGGCAGACGATTCCCTGCCAGAGATGCCAC
CAACGTGCGCATCTCTTGCGCGTACTCCTGCAGCTCACGTTTACCTTGCTTACACGCGAGAAAGCGTGAGCGCTGGCGGAACTCGTTGTTCGCCGGTAGG
AACGCGGCTCGAAGCTGCTCACACAGCTGAGCCCAGGATGCAAAGCATCCAGGAGATGTCGTCTCCCTGGTGTATGCCCAGTGCTTGGCACGTCCACCAA
GGCTGGACAGGGCAAACGCCACCCGAACTGGCTCGTCCGAGATGAGACCCGCCTTCATGGCGATCTCAACCTCACGGACCCAGAAGTGAAGGTTCTCTCC
TTCCTTCCCCTCAAACGCGGGGACCTTCAGCCACACCGGCTTAGGCCTGGCTGCCTGGGGAGCGGTCATCGTGGCCTCCAAGCTCCCGCGGACGTGAGCG
ATGAGACCACGCTCGTAGGTCTCAAACGCGGTCACGCGCTCTTGTTGCTCGGCAGGCGTCGCCGCCGCCAAGCTGCGAAGGACATCTTGTCCAAAGATGC
CTCCCATCTTCCGAACAGACTCGTACTGTGAGTCGTTCAAGCGAGGAAACTCGCTCCGGTCCATCTTGGCTCAAACGTTGAGCGCACAGAGGATTCAGGT
ATCTCAATCTACCCGCGATGGTGTTGGATTGACTACGAGTGCTACCAAGTGTGACGGGGTCACACAGCACCTTGCACAGAGGAAGTGCTTATGGGTATTA
ACTACCCGAGTGAACGTAAGTCCACGTGTTCCCGGCCTCAGTGGGAACGGTTTGCTACTTAGAGGAGTAGATTTTAAGACTGA