Description :
From Genome Similarity Track
Location :
Scaffold_57:43837- 51696
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G014027Protein of unknown function
Pytul_DAOMBR144PYU1_G014026Protein of unknown function
Pytul_DAOMBR144PYU1_G014025Protein of unknown function

Sequence
7859 bases(100 bases per row)
CAGCAATCATCCAGGAGCGCATCCACTCGACGACGGTTGGTCTGGAAGCCACGTCCACGTTCCTGCAGCAACTCGTGTCGGAATTAGAAGATGCAGTCGC
TGAATATATTGCAACTGCAGTGCATCATCTTGAGCATCAGGAGGAAGTGGAGCTCGGAACACTCATCACGGCTTCATCACTGGTACGACGCCATCATTAG
CGCTTACCTTGTTGGATGGTATGCAGCAGCTGATTGGTTTGCTAACTAACTGACTGTTGCTGGAGCAGAGCTTGCGGTATGTGACGGAGCGCGAAGCGAT
GCTGCCATTGCTGCAGCGATTTCGCTCCGCGTTTGCGACTGTTTTGCACGTTGATTCCTGGGGCACTGCCTTTCGGGGGCTCAAGGTAGCGATCGTGCTT
TCATTGAGTAAAGGGGTTGGCAATTGCTGACTTGTACACTCTTTTACTCCTTGTAGACGGTTGCGCTGATGGCGTCGACGCGGGCGCTGGAAGCGTTTGG
AGAGCAAATTGCAGTCGATGACGTTGTGGCGCAGCTCCGATGGCTGATGACAGAGTTGTTGGCGTCTTCGGAACTGAACGAAGTCTCGGTACAAAAGACC
AACTACTTGCTTCGTCCCACGTGCGAGTACATCTCTGTTGCGAGTCAAACGCATCCAGCCGCTGAACGCATCATCTACGTAGAGGTACGAGTCAAGCCTT
GCTTTCAGTGTGCGCTTGTGCTATCAGAGGTGTTCATCAAAACCACCATCTTGTACGTCAGATGTTGCCTCAATTGATGGCACTTGTTCAGCTGTACACG
AACGAATCGAAGGCTGAACAGGATGCTCGCGTCGCAGACTCTGTCCAGCAAGAATTGGTGTCAACGATTGCGGTCCTGGTGGAGGCCAAGCTCCCTGCGT
CTACGACGAATGTCTACACGCTTCTCCCAGTGCCATCGTTTGTGGAAGAGATTGAAGCACCCGAAGCCAGTGATTCGCTTCAACCTGACGACGACGACAT
CGTTGGTACCAGTGAAGGTGCAAGCCAGCTTTTGGAGAGTCTGAGTAGCGAGGACATCAGTCAGTGTGCCATTACGTTGTGCTCTTGGCTGAACCTTCCA
GCGCGGAGAGCATCGGCTGTGCTCATCCTGCCAGTGTTGTGCCACGCTCTCTATGCGTGCCATCAAAGCCTTCCCGCGGTCGAGTCTGTTGTCGACGCCC
TTGTCACATGGTAAGTGCGCTACGATTCACATGAAGTGCGTGTTGATTGTTTGGCGGTTGTTTGCTAACATATACGTATCTCTCGTTCCGCGCAGCTCGC
ATGGTCTCGAATTGAAAAAGCTGCGTGATTTCGAATTTGTGAGCGGGCTTGTGGAGTCACTCCGCGATATCACTTTGCGAGTGCCAAGTCTGCCATCTTC
GTCGATCGCTAGTATTTACAACGACCTTCGCCTGGTGATGCCGCGACTCGAGGTACTGTGCTTCCTCTCTTGTAGGCGTCTCGAGTTATGTGTTCGTTTG
CTGACTTCCTCATGAATGCGTATATCAACAGAGTGCAATCAAGTCACCAGAGCTAGAAAAGAAAGAGCTTCGAGCCATCAAAGCAAGCTGCTCGAAGATC
CGCCAAGCTCTTGTCGAGTCGTTCCTGGCTTGGATGTACAACGCCGGCGCAGAAAACTTTGCTGCGCATCAAGAAGACTTCCTCGCGGTAACCTCGACCA
AGCTGGCTGACCCGCGCATCTACGGGGATGCTGTGCATGTTCTGATAACCGGAAAGAAACCAGATGCCGACGACGAAATTCGTGAATTGGTTGGACACTG
TGCTGACTTGCTCACTCGAGCATTAGCCCAACTTGTTCGATACACGAAGGTGCTTTGGAATATGATGGCGGTCGTTTTATTTATCAAGCGTTTTTGCAGG
AACTGATTGCTATCCTTGTTCTACATATTGATCAACTCAGGTTACTGCGAATCGCATTGTTTCAGCTGTTACGCGCATCGCTTCCGCCAGTGGAAAGTTC
GTCGGATCTCACGCAGACGATCTTGCGCTCCCGCTTCTCGTCTCCATCGTCGACGGTTCCACCAAGGGCAAATCGCTTCGTCTACGCCAGGAAGCGATAG
CATGTATCTTGCTTGGAGTTGCGCAGGATCCTGATTTCCAGGTACATACCACCCCATCATTTACTTCTCTTAGATCGTTGTCACTTACACAACCGCTCTT
TGAATTTCTGTCCTTGTAGTTTGCTGATCATTTGTGGATCAATCAGTATCTTGAAGTCCTTCTTGAGACGGCTGACACTGGTAGCGCTCACACATTGTCG
ATCTTGGTTGGCCTGGTCAACGAACCACGTATGTTGCCCCAATTGGTGAACGTGTGCGTGTCTAAGGGGCCAACCATTGGTCTGATATTTCACGAATCGT
TGTCTCGATGGCCGTTGTACGAGGAAGACATCGAGGCAGTCGTCCTCACACTGGAAATTTTGAAGACGTTGCTCACTGCTGACGCCTTGCGCGCACTTCT
CGATGCCGCGACTATTGCTTCGACAGTAAAGGCGCTCGCGGAAAACGCTGCTGGCGATGAACTCGATGCGGTCGTTGTAGCTTGTAGAGAACTCCTTTCG
TCCGACTTTTTTGAAAAATAGTGCCACGGCCTAACTTTTTTGAAATACACGTCCTAGGCATCAACTGACGTATGGCGCTTCCTTATCTTCGTTCTGACAG
ACGTTGAGTTCGGGGACAATCAACCTGCCATCTTCATTCCACTTGCAGACGTTCCAATAGAAATGTTTTTTCCATCGCTCTTCGCTGGATTGAGTGCTTT
CATAAACTAACCCTTTCAAGTTGTAGACTTGGACCTGAGGCTTCAAAATATTTGCGGTAGAACTTGGTTGGAGGGAAGCAGCGACGCGACAGCGATAGGA
GTAGCCTACAGAAAGGAAGACATGGGTAGCGCATTCCATTAAGTACTTTGGCATACCAGTTCAACCATATATAGCAACAACTTGTACCTTTGCAGCAATT
GAGCATGAATGACTGATGCTCACAGTTTTCCAATTGAGCACTCTGATCCAAAGCGACTTTGTCCCCAAAGGTATGACTGCCCTGGCGCCAGACACGGTCG
ACTAGAGTCTACATGTATGCAAATACACCACGCTGCTTCGTCAGGTGGAATACAGACAGAAAGCTCTGCTCATTGCACTTACCTTGTCTTTGAATACCTC
CACGATAGCTTCCATTGACCGGACAGCGTTCACATACGAAAACACCACCCGATACGAATCTTTTTGATGAATTCTTGGACTTAACACGATTAAGTGACGC
GAGCTGGGTTTGAAGGTATTCCACCCCACATGGATATGAAACCGCGACGTGTAGAAACCCGGAGCACTAACCTCGACATCATATTTTCCAAGTCGAAGCT
GTACGCTAACTGAGCTCCCTAGCGTCAGCATCTCGTCGTCACGAACCGAAACATCTGCTCGAGAGTTTTCTGGATTATGCTCGTTTTCGCGATGCTTCTG
TCGCTGCTGTGCTCTCATGCAAAAGTGGATCGTCGCGAGAGTTGATGATACACTCGAGGTCAGCGGTATCGCTGCAGTGACGATGATTTCAGCCGTAAGC
TTCCCAATGAGCACCGGCATAGAAACGATCTTTGCTGGATGACACCGCCCACCTTCGACGACAACGTTTTTTGATGCCGAATACAGAACGCACGTACACT
CTTTCGAAACAGTCACCGAGTACAGACCTTTGCCAACATCCCACACCGCGCAACCTCGTTCATCGGTTGTCATCGTGTATCGCTGGGAGGTAACCTTGTC
GGTGACATGGATCGGGATGTGGGCTATCTTCTTGGTTTGATTTTGGTCATAGAAATCAACCAACTGGATCTTGTAAGTCCACCGAAATGTTTCTAGTGGC
ACTAGAACATCTTGAACTAATGAGCAGGATATACCATTGCCTCCCTGTGATCCAAACGGGAACACAACCACCAACGATGTCCATTCAAAGTAATCGAGAT
GGAAGATATACAGGGAGTACGATCCAGGTGTCAAGCGACAACTTGCTCGACCATTGGCATCTGTGGCATAGCACTTCTTGCACTCCCGAGCTCTCTCCAA
CGAAGCTTGAATAGTATCATCTGGATCAGTATTTGTCTTTACATCTTTCGAGGTAGCATGCGCTGTATCATCGTCTTTCTCTCCCTTTTGTGTAATGGTT
TGTTCGGCAGGCATAGAATTGCCCTTCATACTCCTTTGCGCACGCCATATTTCATAAACACTGCTTGGATTGTCATGGGATTCTTTTGCACTAGATGGAA
TATAATCCTCTTCTGCAAGCACTTGCAAACCAAACTCCGAAAAATCTCCCAGTAGCTCTTTTTCGCTTTGGGAAAAAACCAGTGGACGTTCGTACAATTG
CTTCAGCCTGATCGGGCCATTGCGAGAGTAAATTCGGCCTCGTTCACTCTCCTTAACTTGTTCCAGAATCCGTTGCTTGCTTCTCTCGTACCGTCGCCGC
ATAGCTCGTTTCAGCATCGCCCGAGATCTGATATACGGCATAAGTTTTGCATCCCTTCGCAATGAAATCAGAGCAACCTTCATCCCAACGCTGATGACCT
CCTCAGTAAAGGCTACAGCAAAAGCTCTTGTGTCGTTCAGCACACGTTTCATCTGAAGCCGACGCCGAACCGAAACCAATAGAGAGCCCATTGTAAGCGT
TGGCACAATCTTCTTGGCTAAGCTGGTAGAGAGATGGATATTGTCGGGGGTTTTCTCAATAAACACGTGCGCTTTTTCCACTGGTGAGTTTGTCTGCTCG
TTGATCACTCGAATTTCCACTTGCCGCTTGACTTTGTTCTCTTGGGCAACAAAAGGATTGTGCTGCAAGCTCTCTTTAATACCATGCTCGGCCAGAATCC
GTAGTATGCTTCGATAAAGAGACTGGATTGTTGGCAGGGTACGATACGAGCTGCCATGCCGATACACTTCAATTGCGTTCTCAGATCCTTGCAGCTTTAA
CGAAATGAACAGTGATGATGACGTTCCAAAACTGTTGCGATGGCCGGTACGTTTTTCTTCACTGTTTACACTTGCCACGATTGGCTTTAGTGTAATTCGT
CCATTTCTTCCGAAACGAATGTTCTTGGAAAATCGCTTCGCATAGCCTTCATATCCACTATCCTCCTCGCTGCCGCTCTCAAAGCTCACAACAATTTCAT
AAATTTGCACAATAGCATGCTCAACCAAAAGCTCGTGCATTCCGTCAAGACATGCATGGATAGAATTTGCTTGGCTGCATCTTCCCAGCGCCTGGATCTT
CCAATGATGAGGTTTCTTGCTGCGATATAAAGCGGCCAACGCGAACCAACGGCAGCTTCGATCTGGGAAGGAATCAAATTTGCCAAGTACTTGAAGAGAC
TCACCATTCTCAATCTGAAGTCTGACGCAGCAATCTTTCTTGTTTCGACAACCTGACGTATCATCACTCCCAGTGTTTGAGTGTGCATTCTCATTGCAAC
CGACCCGTTGAAAGCACAGTAGCATGCAGTAAACTCGATCTGACGTTTGAGTAAGCTTGATATTCACACGGTTGACAAATCCCCCGTACAAATACCGTGT
TTGGTGGAGCGACATTTTATGATCTTGAGTTGTTGGACAGTCTTCATGAATGAATTCAAGAAGCTGGGAATCATGGTCGAGCAGTATGCCAATGAAGCAC
CAAGGGGATTTGAGCATATCTCTCTCGCAATCGAGCGTTGTGCAAATTGAAAGCGTATTCAGCAATGGGAGAGCGTACATGCCTTCAGCTGTAGGCGATA
TCATCGATAAAGAGGGAAGGTCCTCCATTCGATTTCTCTTTCTCATGTGCTCATCCTAGGCAATGACATAACAGGGATTTTCATGCGTCACTAATCGTTG
TTGGAAACATAGAGTATACACACATACCTGGATGTATTTGAAGTAGCGAACCACCTCAAGCAGCTCGGAATTGGCTAAGTAGAAGCCAATCTTCTGTAAC
ACTAAGACTACTTTTCTCTCTGTGAGCACGATTTTTCGGTTCATCACAGCTTCCAGAAAGCTTCGCTCGCGATTCTGCCGAGAGCGACCTGCTAAGGCGA
GATAATATCGGAATGCTTGGTCATGTGCTTCTTCGCCAGGGGACCTATATGAAGTAGCACGTAACCTGATCGATTAACATCTGATTCTCATGTGAACACC
ATACCGTAGCCGGTTGCCACTTTACCGCTTTGCTTCGTGAAGAATGATCGACAAGATTTTCTTCTTAATTTCTTCGGGATTTGGAAAAAACGACGTGCTT
GCCATCGAGTGCAGCTGCAATTCTACGGCCTGTCTTCCAGTAGCGCGGGACAAGAGCATCGTAATCTCAAATGTTCCGATGCATCCTGTGATAGGCTTCC
CATTGTCCTCATTTACAAGTACTGTTAGAAGCGAGCTCATCGATTCAATTTCACGGATGATCGCAAGCGATTTCAGCACGTATTCTTTCTTTGTACGGCA
TCCATGTTCATTCACCATCTGCATGCCGAAATCGAGTGCGTATTTGATACTGATACGTACGTCTCCCGCTTGAATGACCGACAGTAGCAGATTTTCAAAC
GACTTTGAGGTTGTGATCGTCAAATCATGATGAGCGCCATGATAAAAATTGTCCAATAATACTACCCGGGACATTGATGTACGAGGACCAAAACCCGATG
AGTTTGCGTTCAGAAATAGAGGGGACTTCGATATCTCTGGAAAGTTCTTTCGCCAAAACACATTTCTGTGAACATTGATCACGTGATTGCAGCTGGAATA
ATCTCTGACACGACCAACTTCAGCAAAGATGATTTTCAAAATCATCAAATCTCCAGCGGTTCTGATATCCTTCTCTTTCGATCTGCCGCATAAATCTGGT
GACTGCAGCGTTTCGTCTCCCAAAAGCATAGCTGTGACGTTCTCTGTCTTCCACAACTTCACCGATGCGATTAAGCCGATGAATCCGATTCGCATACGCC
AATCACGGACATTTCTAGAGTACGATGGGTGGCCGCCAATATAGATCGAAGTCGAACTTGACAATGAAGCTGCAGCCCAGGTAGTTTGTCCTCCAACTGC
ACCTCTCGGAAGAGTGGATACACTCCGACGAACGGCTGCGACGCACGCCGAATCAATAAGACTGTCATCGACGTACAGTCGGAGATAGAGGCCGTCAAAT
GCTACCCTTAACAGCATCCACCGATCACTTGGTAGGTCGTACTGATTTGCCCAGCATTCATATCCTTTGTACCAGACACGACATCCATAGTTCAATGGAT
ACTTTCTTCTCGTGCTATTGCTACCTTGGAAGCCTCGATCATAAATGACAAAGCTAACCCCGTCCATTTGCTCGGGATTGGGTAATTTTGCCGCAATGAG
CTTTGGTGCTGGAGGTTCTGCGCAGCATCAAATAACAGAATGTCAAAATTCGTCGCAGCTCACAGAGAACACATTATTTTAATCAGTGCCCAACCATTTT
CTTCATCTGATTTCAGCGCGCGGTTTTGAATGACTTTTGCTGCTGTACAACCGTAAATGCATGGATTTGTACTTCCGCAACAGATCCATCGAATAAATCC
TCCTGCCTCGTCGAGCTCTGGATTTCTGTGACGTGATTCCTCTGAGTAACTAAACGATACACAGATGTGAATCGAACTGAATAGTAAGTGGGCATTCATA
AAGCAGTATGTGGTACGGCATACCTCTGTTTCGCATCCGTCTCAATATCTGCAGCCTTGAAAAGCCGAATCTGAATGGAAAATCCATCACGAAGCATCGA
ATCTTGATTACCACTCGGAGGAATCTCAACGAAGCCATCACCGTAAAGCGATAGCACCA