Description :
From Genome Similarity Track
Location :
Scaffold_30:438340- 476657
Transcript NameFunction/comments
Physo_134213endo-beta-1,6-galactanase
Physo_134214endo-beta-1,6-galactanase
Physo_134215hypothetical protein
Physo_134216hypothetical protein
Physo_134217hypothetical protein
Physo_13421860S ribosomal protein L17 (RPL17A)
Physo_115928PREDICTED: similar to mutS homolog 6
Physo_134220hypothetical protein
Physo_134221hypothetical protein
Physo_108766ribonucleotide reductase M2 polypeptide
Physo_134223hypothetical protein

Sequence
38317 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCCATCCCAAGGCTCCGAC
CAATGAGCAAACGGGACGACAATCTATCTTGGACTGTGTATGCATAACACTTTGGGAAGGGGTAGGGTAATACCGTTTTGCTCCGACCGCGCTTGACTGG
GGATTTGTATATCTATCATCTTAAGTGCGGTCGGAGATTTGATGATATTCTACCATACCGAGTCGATCGCACTTTGGTGCCAAATCGCTGCCTACAATCT
CATCGTTCGGGCAGAAGCCTTACATTTTTGAGCCTGGCTCACGTTTCGCTGCGGCATTCCTTTTCGGTTCCCACTTTCGATTATACAGCGTGGGCCTGAC
AGTCAAGACCATGCTTTCTGTTCGAGCGCTCGGAGCTTCAGCTCTGACGTACGCCCTCCTGGTTACGCAGTCTCCCCGTGTTCTCGCCGCGGACTACACA
GTTAAAACGGATGCCTCGACGACATTGATCAGCTCGTGGGAAGGGTGGGGTACGTCGCTCTGCTGGTGGGCCAACGCCTTCGGAGACCGTGAGGACATCG
CCGACCTACTCTTCACGCAAAATGATACCGTGACGCTGAAGGAGGCGTCGTCTGGACTTCCGGCACTCGGGTTCAACATCGCACGCTACAACATCGGCGG
TTCCAGTAAGAACGTAATTGATGACGCTGGTACTGAAATCGCGATGAAGGAGTCGCCTAACATGCCGGCATTCAAGGCCATCGAATCGTTCTGGTTGGAC
TGGGCCAGCAACGACACGACCAGCAAAAGCTGGGACTGGGATGCCGATGCGAAGCAGCGCAAGATGCTGGAGTTGGCAACGCAGCGTGACGTCGACCTCA
CCGAGGCGTTCTCGAACTCGCCGCCATGGTGGATGAACAATAATCACGCTACTGCTGGTGGGGCTAGCGGAACGAAGGACAATCTGCAAACCTGGAATCA
TGGCCAATTTGCGCTTTACCTGGCTGCTGTCGTGAAGCAGGCGAAGGAGAGCTGGGGTGTCACCTTCGACTACGTCGAGCCGTTCAACGAGCCGATGAGC
TCGTGGTGGCAGTTCCCCGGTGGTCAAGAAGGCTGCCACTTTGATGTGGCCACGCAGAAGGATGTCTTGGTGAAGCTTCGCACGAAACTGGACCAGCTCG
GACTGAAAGATGTGGCCATCGCGGCATCGGACGAAAACTCGGACACCCAGACGCTATCCACGCTGAACTCTATGTCAACCGATGCCAAAGTTATGGCCAC
CATTGAAAAGGTGAACACGCATGGCTACGGTAACCGCGAGTCGGATCGAGCACCCTTGAAGGCATTAGTGAAGAAAGTGAACAAGAAGTTCTGGGACTCC
GAGTATGGCGAAAAGGACGCTACAGGGCTCAGCTTGGCTGAGGCTGTCGCTATCAACATCAACGAGATGGGTGTGTCTGCCTTCGTGTACTGGCAGCCGT
TTGACGGCGGAGGCTGGGGTCTCATCAACTCGGCTCCGGGCAATATGACGATTGGCACGGCCAACCCCAAGTACTACGCACTGGCGCAGTATTCCCGCCA
CATTCGACCTGGTATGGCTATCCTCTCTACGGATGACAAGAATACGGTCATGGCTTACGATGCGAAGACCAAGCTTCTCGTACTGGCGACAGTAAACTCG
GGTACCGCTGCCTCGAAGGTCACGTATAATCTGGAGAGCTTTTCTAAGGTGGCGGGCCCGATTAATGCCTGGACGACCGAGACTAGCGGTACGGGCGCAC
TTTACAAGACGTCGAAGGTCGAGTTGTCGGGTACAACTTTCAGTGCGTCGATTCCTGCCGCGTCGGTGATGACGTTCGAGATTCAGGGTGTTGCCATGTA
GACGTAACGCAGGGTTGGTAAGCTCACAAAACACTCACATGTTGTCAATAAATTGGTGTGCTTCCAGAAGCCACACAACGATACCTATAACGTTACCTTC
AAATTTGAGATGCGATCTGCAAGTTGAAGGCCTCAATAGCTTTCGGATCGCAACCCTGTTCTCAGGTTTTCACATCCGAGCTACGATCCTCCGGATTTTG
AGGGCAACCAGCCGACTCGTATCGAACAAAGATCAAGGATGATATGAGGAACCTGATGAGGTGGAATGGAGCCTCCGTTTGTTAATGTAGGTGCTGGCAT
CTACATGAACCGGTACGCATCAAAGCAACCAGTATCCAGTCAACTGTTCCGGAAAACAGTCAGCATGTACGGTACTAGCATCGTCAAAATGAGTCTTCCG
ATCTCCATGTTACGTGACAATCTCAAATCTCCACCATCAAATCTTTACCTGCTCGTGTGGAATGTACTCAGCCTGCCTGGCTCAGTAGCAGTGCCGAGAT
CGATGCAGTTTGCATCAGTGTGACTCCGGGAAAACGCCCGCAGCGCCTGCACCTCCCGAAACCGGGCACTTGCCGCTGCAATCGTGTCCGTCCTTTTCAG
TTCCCACTTTTACTTTTGCGGTGCGCAACAGTCAAATTTCTTCAAACTATGCTCTCTGTTCGATCGATTGCGGCGTCAGCTCTGGTCTACTCGCTTCTAC
TGACATACACCACGGGCCAATGCAGACTGACGCTGCTACGACGCTGGTGAGTTCCTGGGACGGATGGGGCATATCGCTCTGAACGTCTTCGGTGATAGGG
AAGACATCGCCGACTTACTCTTTACTACGAGGAGACCGTGACGCTGAACGGCTCCACGACCGGCCTGCCAGCTCTGGGGTTCAATATCGCACGCCACAAT
ATCGGTGGCTCTGCGAACAACGTTGTCGACGATAGCGGAACCGAGGTGCCGATGAAGACGTCGGACAAAATGCCAGGGTTCAAGTTCATGGAGGCGTTTT
GGCTGGATTGGATGAGCAAGGACCCAACCAGCACGAGCTGGAACCGGGACACGCAAAAGGATGTTTTGGTGAAGCTGCGTTCGCAGCTGGACACTCTTGG
ACTGAAAGATGTGACCATTTCATCATCGGACGAAAACTCGCCCTCATTGGCACTTTCGGCGCTCGCCTCCATGTCGTCGGATACGGACGTGATGGCAGCG
ATCGGAAAGGTGAACACGCACGGCAATGACGGTCAAAGCCTGTATCGCGGAACTGACCGAGAGCCCTTGAAAAAAACTGGTGACCCAGTCAAACAAAAAA
CTCTGGGATTCGGAGTATGGATCGCTCTTGACATCAACCAGATGGGTGTATCGGCTTTCGTTTACTGGCAGACACTCGACAGTGGCGCTTGGGGCCTCGT
TGAATCCAACCCAGGCGATAACTGGATCGGCACGCCCAACTCCAAGTACTACGTGCTAGCGCAGTACTCGCGCCACATTCGGCCAGGCATGACCATCTTG
TCAACGGATAACACCAACACCGTCATGGCGTTTGACTCGACTTCAAAAGTGTTGGTACTCGCGACGGTGAACACGATGATTCGGCGTCGAAGGTCACCTG
TGACCTTTCGAGCTTCAAGGCGGTGGCGGGCCCGATCACTGCTTGGACGACAGAGACAAGTGGCACTGGCGTGCTGTACGAGTCTTCGAAGGTCGACTTG
TCGGGCACGTCGTTCAGCGCGTCCATCCCGGCAGCGTCGGTGATGACGTTCGAGGCCCAGGGTGTTGCCGTTTGACCCCTTTAAGGGTTGGCTTTTGTTG
TTCACCCGCACAGAGCACTATGTACAAGCCGCCGTTCGTAAAAAAAAAAATCCATACTCTATGATAGAGTATGAATTGTTTTTTTATAGAGTCTCTATCA
TTCACCAAAACGCTCACTTTGGACACTCAAAGCCGAAAGTACGGTTTGCTTCAACTACACTGTAGAAATAGTATTTCTGAAATACCAGCCAGTTCAGCAA
CCAGCTTTGCAACCGTCATCTCATTGGTTAAAAATGGTGTACCAGGTAATGTGTCACTTTGCTGCAGCCCTTTGAGGTTGCTTTATGAGCAACGCGCTGT
GAAATGAGCTGAATAACTCTTGTGCATGTAGTACTGACTGCGAGAACCTCTTTGTAATACACTAGCGTCGCTCTCGTAGGTGCAGTACCGACCGCGAGAA
CTGGTCACGGCCTTGTACTCCTTGAACGCCTTAACTTTCTTCGACAGAGCGGCAACAGCTCACGCGTGTAGGCAGTACTGCTGCGGGGTCCTTCCATACC
GATTTTATGAGTCTGTAGCCGCGGGACGGCTTCCATTTCACGCAGATTGCTACTGTGCGGTAGGTCTGGCGGGCTGGCTTTTATTTGTGTGAAGATGTCT
GAAATGATGACACAGTTTACCTGCGTTCTCTCATCTCAGTGAGAGCTGGATAGAGTGTGCCTCTGATCCTACCTTGTAGCCGTAGATGAGGAAGTGGTAG
AGGTAGCCTGCATGAAATCGTACGGGTTGTGCAGCAGCACCAGGAGGGTGCGGAGCTAGCTCTACCGGTAGCCCCGCCGCCATAACAGGCCTTCGGCTCC
GACGTGACCTCCTACTACGTGCAGGTACGACAGTATGAGCTGGTTCGACCAGCCATGGAAAGCTCCAGGCCGCCGTTGGCGGTGCCACGGCTTGCCACGG
TGATAAACGCTTTGCAACCCTGCATAAACGAATTCACTTGTGTTTTGTATACTGTCTCCCATACGGCGTCGTTTTGCTACCGTGACTTGCAGTTTGTATA
GGAGTTGAGTTGCACAACAGACTAATACTTGCTAGTAGCAAGTTGCTACCGTGTGCGCAACCGAAGTTGCAAGCGATACCGTACCATTTGGCTACAGTAC
AAGCAACAATCCTGGTCGATACCATAGGTGGCGATTTCTAGAAATACAACCTGGGTTGCAAATGGCCGGTAATGTACTAGTATCTGAGGCCAAATACGGC
CAATCAAATTCGTCCTCGCAACCAACGCGATGCAGACTCGAGAAACGCCGGGACCCTTCTCACTCGTCTGTGGAGACCATGGCGAGCCCCTCGGAGGTCC
CAGCGCGGCCTGGCCAGTTGACGACTGAGTTTCTGCAGCAGATTCTCCGTCCTTTGTATCCGTCGCACCAGGTGGTTGACTTCGACTGGAAGCCCATGAA
CATCGGCGTGATCGCCGAAGTGGTGATCATCTCAGTGGACTTCGAGCCTGTCGATGGCCCCAGCGATGCCACCAAGCTGCAGCGGCGATACGTGGGGAAG
TTCTTGCGCCCAGAGTTCCCGTTCGAGTCGATGTTCGCGGTGGAGTCCAAGTTCTACAACGAGTTCACGACTAAGGCAGGTGATGCAGCCACGAGGAACT
CGGCGGCAGTGGTGGGGTTCCCGTTTGCTATCCCGACCGCAATTTTCACGTCCAACGTGCTGATTGTATTGGAGTGCATCGAGGCAGTAAAGACTTTTAC
TTGCGTTGATGGAAGCCCGCCCCACCACATTCCGATGCTGGTAACGAAGCTCGCGCAAATGCACGCACGGTTTTGGAGTCACGACTGCGATGATCTTTCA
TCCCCAGCAGGAATCGGCAGCCAGCTTTCCGGCGAAGAGAAGCGCCTGCAGTTTCCGGGCCGTTGGGAGACGTTTTTGGACGACGTGTCCTTGGAGCTCT
ACGAGAAGGATCAGCTGACCGAGTTGTGTCAACGTCTGAGCGAAAAACCTGACCAGCTCAAAGCAGTGCACGACCTGGTGGACAGCGGCCCGACCACGCT
GATCCACGGCGACTTTCACATTGCCAACATGCTTTTACCGACGGACCCTGCGGACGATGTGACATGGCTTCTGGACTGGGCAACGTGCGGTAAGGGAAAC
CCGCTGCGAGATCTCGCCTTCTTTTTCATCGTGAGTGTCCAAGCCAGCCACCGTCGCGTACAAGAGGCACAGTGCCTGGAGGTATATCACAAGGCGTTAA
CGGCAGAAGAGGAGGCTGTGCGCTTGTCGTTGGACAAGCTGCACCGACAATATAAGGCGTGCGTGCTCAACCAGTTCGTGATCTTGGTTGTGTACGACAG
CCTCAGCAAAAGCCTCGCAGCAAACGCGAAGACCGAGAAGCTCCGCGTGGAGTTGGACGCACATTTCCGAGAGGTTAATTGTCGCGCGTGCTTGAGCGTC
CTCGACAACATCGGGGAGAAGGACATCGAGCTCCTGTCAGATGGTCGCTCGTGATCAAAACCTACATACTAGCTATAACTTCAATCGGAAGCCACATGTG
TGTTTGTCTTGGACTTACATCCTTTGCATATCGATTAACTGCTCTTGCCTCCACACGTGCATGTGTATCTTGCTTGCTCCGCTGTCGCAGCAGATGATGC
CTTCTTGCAGATTACGATGGCACGGATTGAGTAGGCAGTTGATCCTGCTTCATCGTAGCGAAGTTCGACACCCTAGCGGCCTGAAAACGTGCACTTATGC
TCGACTCCCGCCTTTGGGTCAAATGTGGCGGCCCTGAGTCAGCTGGAGGTAAGATGGATGGCTTTGGCTACACTCAAGACCTTGTGTGAGCAAGGCGGCC
TTGAACAAGGCCACCATGACGGGATCAATTGACCGCTGCACCACCTGCAGCTACTGCGACCGACTGGTCAGACATAAAACGCACTGATCCAGTCGGTCAC
AGGAGCGTCACCGTCGGCTCTGCGGCATACGAAGAACCGCGGTGAAGGGAGCACATCTCGAGTGACCTCGCAGCGTTGGCGAACATGGCGCGCTCCATCC
CGAAGCCCAACCCGGTCCTGGACACCCTGCTGGTGAGCCTGCTCGTGTGCGAGCTGGGGGTCATCACGCACACGCTGTGGGACGACCAGCAGATGCTCGC
CATCCTCGTGGCGATGGTCTTCGTGGTGGCGCTGGCCGTCAAAGTCACCAAGACCTCGTTCGCCATCGGTGGCGGATGGTTCTCTCGCACGTTCCTGCAG
CACCTCGGAGACCCGTTGAAGAAGGCGGTGACCATGAAGAAGTGGTGCGACCAGTCGTGGCAGCTGGCCATTCACGTGTCCATGACTATCTTCGAGCTGT
ACGTGCTGCGCGATGAGACGTGGTGGCAAGATACGACGACCTGTACGTGGCCCACTTGTCCCTTGGAGAGCTTTGGTGATCGAGTCTAACTTGTTCACTG
CTACTGACTTACTGCAGTGTGGAACCAGGGAACGGACACAGGCGTGTTCCCCACGCAGAAGTTTAGCACCAAGTTGCTCTACATCACTCAACTGGTACCG
TGGATGACGCGAGCTCTTTTTGTTGACGACTGGCTGCTGACACATGGGCGGTGTGCACTTTGGTCGTTCGTTTCACTAGGCAATTTGGATCTACACGGCG
TTCTCATGCAAGTTCCTGGAGGAGATCCGCAAGGACTACTTGGTTATGATGACTCACCACGTCGTCACGATCGCCCTCGTCACGTGGTCGTACGCCGTCG
GCTTCTTGCCCGTTGGCGTCGTCGTGCTGCTCCTCCACGACATGACGGACATTCCGCTTGACATGCTGAAGATGGCCAACTACCTCAAGATGGAAGGCGT
CCCCGGCTTGTTTACGAGCGAGATCCTCTTCGTCATCACGATCGTGCTCTGGTTCTACTACCGCATTTACCAGTATCCGACCAAGCTGCTTTACACGACG
ATGGTGGAGAACCGCGAGGCCAGCATGACAATGGCCGACGCGCACGACTTCACGCAGCTTTTCCCGCATCCCGGCCCTCCGTCCTGGCTGCTTTTCAACG
TGTTGCTCACCACACTGTACTGCCTGCACATTTGGTGGGGCCTCCTGCTGGTGCGGGTGCTTATCGGCGTGGTAACCAAGGGCGCCCACGATACGGCCAA
GGAGGAGTACGAAGGCACGTCGTCCGACTCGGACAACGAAAAGAAGGACGAGTAGAAAGAAAGAGGGTATTGGTGCAGTGCGCGCACGAGAAAGAAGGCC
TAGAGTTACGGGAGGACAACATCTAAGCGAGAAATGAAGTGTGCTGCTACATGCTTGCACTGGACAAACTTCAACCAATCAGTACCTTTTCAAATTATAG
AACATCTAGATTAGAAGATTACAAATTTTGGCGGCAAATTCGGTTTGATTCGCTATGCCACCATCAGCCAATCGGCTTCGGCTTCACCTCGACAACGTTG
CTGGGAGTGCAGTGCGTGGCGCGTGGGGTAATAGGCAAGTGAGCGGTCCGGCAACATGATGGAGGCGCTGGGCGACGATCCGGCCGTGGCGGTTGAGTCG
CTGGTCACGGAGGACTCCATCGTGAAGGCGCTGCGAGAGATCCTCCCGTCGATGGACGCCGACACGGCGACGCTGAAGGCGGTGATGCAGAAGCTGGCCG
TCCGCTTTGGCATGACTTTCGCAGACCTTAAAGCCCAGTGGAGACCTCGCATCAAGGCGCTACTGCCGGACTTGCTGGAGCTGTGCGCGGGAGGGGATGC
CTCTGAAGCTGAGGACGGGAAGGATGAGCCTGCGGCACAAGAAGAAGACGAAGAGGAGGAGGAGGTTGATCTACGTCCCAGCCGGAAACGCACGGAACGC
GCGACGAAGAAGCGCAATGCAGTTGTGGAGGAAAGTGAGGAAGAGGACGAAGACAAGGATGGTGCTAATGAAAGCGAGGCCAGTGAAGACGAAGCTAAGC
CCGAAGAGGATGACGAAGATGATGACGAAGAGGAAGTCGCTCCAGTGAAAAAGAGAAGGACGGTATGGGCCCCTTTTGCTACTGCGATGAGATTTACGTT
GCTGTGTAGAGAAGTTTGTGCTGATCGTAGGTTTTGTCATGCAATGCGTTGCAGTCTGATAACGGTCGCGCGAAGAAGCGGAAAAACAAGGAAGCGGCGC
CACCGGCAAAAAAACCAAAGACTACCAAGCAACAGGATCCACCTGGACTGGCCTCGCTGAAAGAACTGGGCCGTGCGGCAGGCGTTCTCAAGTACGTGTT
CAAGATTGATAGTAAATGTGCGGTAGCCTTTATGCTAACTACTGCTGGATTTGTCATCGTTGACTGATGTGCAGCCCGCAGTTGTACAGGGTTCTGAAAA
GCGCTGCTTCGTCCGATGAGGCCGAGGAAATTCTACGCGAACGGCTGCATGATGCTGGGATTTCGTTCCAAGGGTCGTACCCTTCGAGTCGCGATATCAG
CGCTGCTAAGAGGAAATACAACAAGGAGAAAGACCTGGAAGGCATCGACACGAGCTTGATCATCACGGGTGGTCGCTCGCGACGCGGAACATCCCAGCCC
CGCATCTCGTACAAGGAAGAACGCATCAGCGGCGAGGAAGACAACGCCGATGATGACGACGATGACGAAGACGAAGATGCGGAAGATGAGGACGACAATG
AGGATGACGCCGAGGAGTCTGCAGCCAGCGACTCGGGCGAGTCCGAGGCATCGTTTTAAGGCAGCAGATTTTGCGCTGCGCTGCTGTTTTCTGGTCGCGC
AGAGAAGATGCATGTGAAGTACGAACGTAGTTGGCGCAACTAATAGAGAGGCCTTGCTTGACAAGCAAGTTACATGTTGAAGTCTTGTCGAAAGCAGGAT
ACAAATCAAAACCTTCTAACCGGTTCAGGGTAGGGTACATGTGATAGGCCCGGTTCAACGTCTGTTTTGACTTAGAATATATGGTCTGTGCTCCTAGTTT
GGGGAAAACGTGTTTTTCCGGCCTTCACACTGGTTTGGGAAATACAAATCTGTGTGGCGCACACAGCGTTCAGGTGATTGGTGGTGGGCGCGCGAGGCCG
TTTGGTCTTGTGTGGGGCGACAGCATTTGCCGCGCACCAGTTTCCAGAACCCGAACGTGAAGCAATGCCGTCCTACAGCCAGGAACCTGAAGACGCTCAG
CGCGCCGCCAAGGCCCGCGGCTCGCACCTGCGCGTGCACTTTAAGCACTGCCGCGAGGTCAGCCACGCCATCAAGGGCATGCCCCTGAACAAGGCCAAGA
GCTTCCTCCAGGCCGTGCTCGAGTACAAGCAGGCTGTGCCCTTCACCAAGTTCACGGGCGGCTGCGGCCGTCACGCCCAGGGCAAGCTCCGCGGCGCCGC
TGGCGACAAGTGCAAGTGGCCCCAGAAGGCTACCAAGATCATCCTCGACCTGGTGAAGAACGCCGAGGCCAACGCCGAGGTCAAGGGCCTGGACACGGAC
CTGCTGTACATCTCGCACGCTCAGGCCAACGCCGCCATTAAGCAGCGCCGTCGCACCTACCGTGCCCACGGCCGCATCGGCCCCTACATGTCCAACCCGG
CCCACATCGAGCTGATCCTGACGGAGAAGCGCGCTAACGTTGCCAAGGCCGCGGAGGAGGCCAAGCCCGTCAAGGTGTCCCGCAAGCGTCAGGCTCAGCT
GCGCCTCAAGTCGGGCGGCGGTGTCCCGGCCAACTAAGTTGCTTTCTTCCTGAAACACGAATGGTCAGTCTGGATCGAGCGACTGTAGACGCGAGGGGGT
GGCAAAAAGTTGCTAAAACTTTTTAATACAGCCTTGCCGAGAAATGGGTTCTACTGATGCAGTGTCTGTTGCCAAGAGAGCAAGCGCGTTTCCAGTTCGT
CTTCCGTGCGGTGTGGATGGTGGCCTCGCGGGGTATCATTGTGGATTGCCTTGATGCGTGCAGGTACAGGTTCAGCAGCGGCGGGTGATGTCAGGGCGGC
GGGGACTAGCGAAGGAGGTGCGACGCCTGCGCGGCGTAAAGGGGACTAAAGCGATCAGCCGTGGAACAAGCGGGGAAATACCGGAACTGGACAGACTAGG
ATGGTGGACCAGTTTGCTGGGCCTCGATGGATACAAGATCACCGACGACAGCGTTGCTGTGTGTAGCAGCGAAGACGGAGGATAGCAAGTCGACCCAAGC
CTGTAGTCGATGCCTGGACGGGAAGTGAACTACCCACACTTGCAGCGTGCTCGGGTCCTGCACAGTCATCCACCACTTCTTTGCTCCGCGGGCGCTAGTC
TCCTCGACTGGTGTGACGAGGCTGATGCTGTGGAGACGCATCACGTGCTTGAAGTTGCCGTAGTGCAGAAGGTGCTGGACTTGATCGAGGTGCAGGTGCT
GCAATCGCTTCTGCATCTTCGGCACGAAGAAGCCCACAGGTTCTGCGATGTAGAGCCACTCGCTGCCCGCTGCGGGATCATGTTCGCTGACGACGCTGTC
CTCTTCGCCTGTGTCGGTGTCGTGATCCGACTTCAACCTTGACGGACAAAGCGAGGAAAAGCGTCGTCGCCATATCGCCCCAACACCAAACATAGCACGC
GGTTGCTAGCTCGAGTCGTCGACGTCGTTGTTACACTGAATGCATCTTTCCAAATACATCGCAACACCATGCCAATCGCTGGTCCCCAAAAAGCTTTCGC
CGCCTTCGAAATGCCTTCAACTGCGCTACGGGTAGGTCACTCGAAATAGCCCTTGGGAATGAAAAGCTTTCATCAAAGATGAACACAATTGAGCCGACGA
GACTCAATTTGTGCGCCAAGGCGCACCTATTTTTACATTTTACACACAATTTGGGCTCTTCAATTCGACCTAATTTTTGGCGGGAGCCGCCGCGAACCAC
TCGCAAACGGAGCGCGCAAGATGAAGCAGAAGACGCAGAGCTCGCTGCTGAGCTTCTTCAGCCCGCCGTCGTCCGAGGGCGCGTCGGCCAAGAAGAAGAA
GGCGCCTGCTGCCGCCGGCAGCAGCAACGGCAGCTCTAAGAAGAAGGCGACCAAGGCGCCGGCCAAGCGCGAGTCGCTGGGCAACACGCGCAAGAAGATC
GACTTCTCGCCCAAGCTGAAGCAGAAGCCGGCGACCAAGGAGGCAGTGGAGAGGGCCAGCGATGACGTGGAGATTGAAGACACTGAGAAGCCGGCTACGA
AGAAGAGCTCCAAGCGCAAAGCCTACGAGGATTTCCTCGGTACCGACTCGGAGGAGGACGAAGAGGAGCCCGTGAAGGCTCAGGAGAAGAAGCAGCAGGA
CGCGGAGAAGGCGAAGGAAAAGAGCAAGGAGCCTGAAAAAAAGCGCACACAAGTCCGCCCTGGCAAGATCATCATCCAGGACGACGACGACTCGGACGAG
GAGCCGGTGGCGCCAGCGTCTCGACGTCGGACGACCAAGACAGCAACTCGCAACGCTGTGAGCAGTGAGGAAGAGTGGGAGCAGGACAGCCCTGAAGAGG
GCGGCGATGGCGAAGAGTCGGAGTTCAGTGCTGCGGAGGAGGAGCCTTCGGATGACGACGACGTTGACGATCTCGTGGACGAGGAGTCGGAGGAGGAAGC
CCCGCCGCCCAAGAAGCGTCGCAAGAGTGCTCCGGCGCCAAGCAAGGCAAAGAAAGTGTCTACCAAGTCATTCCTGTCACCCCCACCCGCGGGCAAGAAG
AAGGCCAACAGCGCTACTCCGTCGAGCGGCAAGAAGTCTGCGCCTCTGGCTGATGGCCCCGACTTGCCCAATTCAGTAGCGGGTGCTGGCAATCACATTC
ACGACTCCCTGCCCTGGCTGCATGAGAAGCGCCGCGATATCAATGATAACACAGCAGACTCGCCGGATTATGACCCTCGCACACTGAAGGTGCCGCCGGA
GTTCTTGAAAAAGGAGACGCCGGCGATGGTGCAGTGGTGGGAGGTCAAAGCGCAGAACATGGATACGGTGCTGTTCTTCAAGGTCGGCAAATTCTACGAA
TTGTTCCACATGGATGCTGACGTTGGTTTCAAGGAGTTGGGGCTCATCTACATGAAGGGAGATAAAGCTCACTCTGGCTTTCCAGAAATCGCGTACTCTA
AAATGTCATCTCAACTGGTTGCGAAGGGCTACCGCGTTGCTCGCGTTGAGCAAACGGAAACTCCCGAGATGCTGAAGGTGCGCAATAGCTCGCTCGCTAA
AAAGGCGAAGGTTGTTCGCCGTGAGGTATGCTCTCTCCTGTCGATTGGTACCAACACTGTCAGCTTCCTGGACGCTCCAATCTCATCTCAGGACCAAGTG
TCGAAGCATCTTCTCGCGCTAAAGGAGGCTTTCGACCCCACACAAAAGACTGTTCGCTTCGGCGTTTGCATGGTGGATTGCTCTACCGGCGCGTTCCAGC
TGTCCGAATTTGATGATACTGAGCAGAGGGACCGTTTGAAAACGCTATTTGCTCAGTTTCACATCGTGGAAATTGTGACAGAGCGATTCAACATTTCTGA
TGACACGAAGATGACCCTCAAGCATTCAGCACCTGCTGCGATTCGCTCGTCACTGCGCGTGGGAAAGGAGTTTTGGGGTGCTTCGAAGACCATAGATGAA
ATTGAGCGTGCGGGGTACTTTAAGGAACATGGATGGCCGGAAGACGTACTGCACTTTTTGGAAGTGGATAAAGGCGTGAAGCCCGAGGGTCAACTTGCGA
TCAGTGCTCTGGGTGGTTGCATCTGGCACCTGCGACGTAGCATTATTGACCAAGAGCTGCTCTCCCTGTGCAACTTCAAGAGATACAAGCCTTCGGATGA
GGAGGCACGAGAAGCACGTGCAAACAAGGAAGCGCTGTCCGCTGCTAAGGCCGAGTTAAACCAGCAGTATGTGGTACTGGACTCGCAGACTATCCAAAAT
CTGGAGGTGCTTTGTAACAGTTTCAACGGATCCCGCTCAGGATCTCTCATCGATATAATGGACAAGACCGTGACGAGCTTTGGTGGGCGAATGTTTCAGG
AATGGGTGCTAAAACCTTTGTGCAAGATTGGCGACATTCAAGAGCGCCTTGATGCCGTTGAAGAGTTGGGCAACAGCGGCGACTTGATGATGGAAATTCG
GGAGTTCCTCCGCAAATTGCCAGATTTGGAGCGTTTATTGTCGCGAATTCATGCGCTCGGATCTGCGCATCGATCCCAAGAACACCCGGACAGCCGTGCC
ATTATGTACGAGTCCCAGACTTACAACATCCGAAAGATCAAGGAGTTTCTCTCTGTCCTCAACGGCTTTGATGAAGCTATGAACCTCACCCTCGAACTGG
GGCCTCGCCTGTCACAGTCCACCTCTCCAATTCTTCAGTCATTGTTGAAAAGGTACCAAATTGAGGACGGCGTCCAACCGGACATTAAGCACGGACATTT
CCCCGATCTTACAGAGAAGTTGGAGTTCTTCAAGCGCAGCTTTGACCAAGCAGCAGCAAAGAAGAGTGGTGTGATCGTGCCCCAAGATGGTGTGGACCCC
GAATTTGATGCAGCTTGCGCTGACATCGCTCAGATCGAAGCTGAGCTAGCAGAGTATTTAAAGGAACAGCGCAGTGCGCTTCGATGCCGAGACATTAACT
ACTGGGGCAAAAAGAAGGAGGACCGCTATCAGTTGGAAGTTCCCGAGAGCGCTTTGTCGAAGCAGCCGAAAGAGTATGAGCTGAAGTCTCGCAAGAAGGG
GTACAAGCGCTTCCACACTCCCACGATTCGTGGCCTGTTGAAACGGTTGGCTGCAGCGGAGGATCAAAAGGAGGAGGCGCTAAAGGACCAGACACGTCGC
ATCTTTCACAAGTTTGACGAGGACTACAAGTACTGGATGAAGGCGGTGCAGTGCTTGGCTGTGTTGGACTGCTTGGTATCCCTTGGACTGCTCAGCAGCC
AAAGTGAAGGCTATACAAAACCGGAGGTGGTGGCGGCGAGCGCAGCAAACGGAGGAACGCCTTTCATTGATATTGAAGAAGGTGTGCACCCCTGTGTTGC
TGCAACTTACGGCAGTGGCGACTTCATTCCGAACGATGCGCACCTCGGTATTGAAGGTAAGGGCCAAATGGTTCTCCTCAGTGGACCAAACATGGGTGGT
AAGTCGACGCTGTTGCGCCAAACGTGCGTACTCACGCTCATGGCCCAGATCGGAAGCTTCGTTCCTGCTGCCAAGTGTCGTCTCAGCCCCGTGGACCGCA
TTTTCACGCGGATTGGTGCGTCTGACCGCATCCTTGCTGGCCAGAGTACTCTTTACGTGGAGCTGGCCGAGACGGCGACGATCCTGAACCACGCTACCAG
CCACTCGCTCGTGATCCTGGACGAGTTGGGACGTGGTACGTCGACGTTCGACGGCACTGCTATCGCGTACTCGGTTGTTGAGCATTTGCTGAGCGACATC
CAGTGTCGAACCATGTTCGCTACTCACTACCACTCGCTGGTTGAAGAGTACGTGGGCAACGACAAGGTCTCATTGGGCCACATGGGATGCATCGTCGACC
CGGAGAATGATCGCAAGGTCACGTTCCTGTACAAGTTGGAGGACGGCATGTGCCCCAAGAGCTACGGCATCAACGTCGCCATGCTGGCCAAACTCCCGGA
CGAAGTGGTCGAGTGCGCTGCGAAGAAGTCGGAGCAATTCGAGCGGTCCTTGCAGGCGAACTCACACACAGAGCTTGAGACTCTCCGGCTAGCGCAGAAG
GTGAAGGAAGCACTCGAAGAAGGAGAAGCCGGTGTTGACAAGCTCAAGCAGCTCTGGCAAGAAGCACGCGCCGCCATCCGCGCTTCAAGTGTCGGCTCGC
CAATCATGTAGCCCTCAAGCCAGAATCGACGCGCTTTTTCGTATCGGACCGAAACCCTGCGCTTGGCTCGACTTCTCAGTAAAGTTGGTAGAAATCATGA
CTTCCTCGTAGCCATCTGACGTCAGATGGCTACATACATCTATACCGAAATTAACGAAAAATCCGAAAATAAGCCGAGTTATCACTGCAGTCATTCCAAC
GCAGCAATGCGTCAAGACAAGTCGCTGGTGGAGCTGGCTGTAGCGGCGGTGGCGCTCTTCACACCCGTCCAGGAGATCCTCGACTATGTCGAGTACCTGC
CCACAACCATTCGCCATCGGCTCTTCAAGGAGCTGTCCAACTTCCGGCTGCGGGAGATGGAAGTGGCCTGGGAGGCGGCTGCCAAGCTGGAAGCCCCAGA
GCCTCGCGACGGATTCGACCCGCAAGCCGGCGACAAGTTCCTGTTCGACCGAGAGACGCAGCGCGTGTGGGAGCTCCGCATGAAGGCAGCAAGACTGGGC
TACGAGCCGATCCCCATCGAAAACACGGCAGCAGCTCAGGGCCGCAGACGCAATCACCGGAACGTCTTCTGGGAGCACCAGTTCCGTACGCTGCTCAAGC
TGCGGACACCGCTGGACCTCGCGGGGCCAGTCGACGTGTTGGTGGAGTGCCAGAAACTTTTCGTGGATGTTGTGGAGGTACTGAAAGTGCACGGTCGTGA
GGTTTGTGAGGACAACGTAAAGCTGATCTTAGCGCTCGGACGACTGCGACGACTGGAGGTGCATCACCCAGAACAGCAAGGCACTCACTGGGAGTCTATG
GAATCCTTGATGCAGGGTCATTCGCATCTCACAGAGCTGGGGTTCTTACACGGCAAGTTGAGCGACAACCAGCTCGCTCAAATCCGTGGCGCGCTGGCGA
AGCCCCCCACCATGTTGGAAAAAGGTTTAAACTGCAGCAGGATCACGACATTGGAGCTGGTCTCTGTGAGAATTCGGCCTGAAGGGTTCCGCCAATTGGT
ATCACTGGTGGCGGAGATGAAGCAACTAGCCCAGCTGAGGGTGAGCAATACCATCACAGATTTCGAAACGAAGCTACTAATCGACGCAGCACTTTGCGCT
CCAAAGCTGCAAAGGCTGTTCCTGGAACACAACGAGCTGGAAGTTGATGCATTCTTGGGTCTCTCGAAAATGCGAAAGCCGTTAGCATTGCGCCACCTCC
GTCTCAGCGACAACGATGTGTCGCCCATAACGCTGGGGGCTATCTGCAGCGCCAGCATGGATGGGGTGCTGAATCTGGAGCGGCTTGAACTGACGAACAA
TGTGCAAATTGGTGATGCGGGTATACACGCGCTTACACCAATGCTAGCGTCCCCCAGTGCTGAGCCGACTGCAGTACTAACTCATTTGGATGTTCGCGGC
TGCAATTTTGGCCTCGAAGGTGCCACGTCTCTACTGCTTGCGTTGGGCCAAAACAAAACGCTGAAGCACTTGAACCTCGCGCAGAACTTTTTCGATGTTG
GCTTTGGTGACGTACTGGCAGACTTCTTGTTCACGAACCAGTCCGTCACAAATTTACAAGCGAACGGCGTCGGATTGGGTCTGGCAGGTGTGTCTGCTCG
ACTGCTGACGGCATTAGAGAGCAACACCACACTCACATCTCTTTCATTGGGGGCAAACCGGTTGAGAAACGACGGTGCATCTGCACTGCTTCGCTCGCTG
ATTAAGCGAGCACAGAAGAAACCATTCTCGCTGGTTGACTTGAGTGGAAATTTGCTCACATTGAGTGGACTAGCGATGTTAGCCGACATATTAGAGAACC
CCACCAATGACACCAGTTCCCACTCGAACAACTCCAGAAGCGACGGTGAAGGGGGGACTCTATCCGACCGCAAGCGACGACGCACTAGTAGCTCGGACAA
TCGCGACAACTCGCTGAGTCCTTGCAACGCCAATAGCAAGCCAATCGAAGAGCTTTGCCTGCTCAATAACGACTTCCTCGGCGCTGATGAGTACGTGGGC
GACAGCTCCAAGCTTATCGAGGCTATTCGTAGTCGCGTGGGTCACCTCAAGAGCAACGAATGGGCTATTCAGCACCAAGTGTACGACGATGAAGTGTAGG
GCAAAATAGAATTCATGTACCATAACTCAAAAATACCTCGCTGTCTGGAGAAACCCGTTCATACCACAGCGGCAGCCAAAACTAAAGAATTTCTCACTCG
AGGGAGCTATGGAGACCTTTTACTCAAAACACTCGCGATGTCCACGCACACAACACTCAGCGCCAAACGCACGACAGCACGCCTCGACTTTCGCACCTAT
CTGTCCGAGGCAAAAGAGCGCATACTCAAGTGCATGCCGAATTCGTGATCGACGTACTGGCGCTGACGCCATTCACGCTCTTCCTTCCGTTCCATGAGCT
CCCGCTGCTTCTCTTGTAGTTCCGCAATATGCGATTCCAGTGAGTCGAGGATGCTTTGTAGTGGATGCGTAGCTCCCTCATGCTCGTCGTTCGACGTGGC
GCTTTCATCATCAGCCTTGTGGCTTTGATAGTCGTCGTCATCATCTCCTTCATCATAGCCTTCGTCTTCCGCGTCGTCTTCCTCTTCTTCTTCCTCCTCC
TCCTCCTCCTCGTCGTCGTCCTCATGCTTTGTCATTGTTGACTTCTCATCCAGTCGGCGCTTCTTGGCCAGATCAAAATTCTTTCCGTATTGATCGTCTT
TACCTCGCTTCAATGGCTTCTTTGAACTTTCAGAACCAAAATGCCTTGAAAGCGAGTACGATGAATCTTCCTGTGTATGGCGGGCATCCTTTGTATCAGA
CTTAGCACTCGAACCCGACCCTGCGCATCGAACATAATCACTTGTCAGATTCTACATGCACTAAGCTCAACGCATGTCGTACGCAACACGCACAGGCGTT
ATCGGACGAACCAACAGATTGGTTATCGAGGCCGTCGTCATCAAGATCGGCATCAGCACCCGCCCCATCGTCCCACGTGTCCTCTTCGGTGGTAGCAAAG
GAAGAAAAACAATATAAGTGAACCAACACCATCACAATTTAGTACATGAACTATACCTGGGCTGGACTGCTTTCCTGCCGTGATCGAGCTGTGTTCATCT
GCGCCGTCCTCATTTCCTGTCTGAGGAGTTTGTGCTGCAGACCCAGGAGGAGTAGACCGTTCATGTTCACATTCGTCGACGATTGCATCCTCATTACCCG
TCCGCGGTGTCTGGGCTGGAGACCCAAGAGGTGGAGATTGTTGGTGCTCACACTCGCTGGTGGCAGCATCTTCAAGGCGCGTTTCGGGTATCTGAGCTAG
GGTCTCGCGAAGAAAGGGAGACCCTTCATCTTCAAACTCCTCGGTGACAGCATCCTCGAGATCCGTCTGCGGTATTTGGGCTGGGGACCCGAAAGCTGGG
GATCCACCAGGCTCACAGTCCTGTTCATCTTCATCTATCATAGTTTCTGCTGCTCCATCAAGGTGATGCGGGTCAGGTATGTTCTCCTTGATTAGATCGC
TTGGTGCTTCAACAGTGGCCGGAGCAGCGTTCACCACGGATTTTGGCAGACGCCCGTGCCCTTTTGCCTCTTGCTCCGAGGTTGCCATGCAGGAGTTGAC
ATCGGGTGCCCTCAGAACAATATTCTCGAATCCGTTCAATGTGCCGAAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGTATTTTTAATA
TGCACGAAGCTGGCTATGAACACTGCCGCTGCGACCTTTAAGACTTCAGGAGCCACGCGAATTGAAGGATTGCATGGCGCGCGACGGCCGACGCGGAACG
ACGACCCACCCACCCACCCATTCACTCTACAGACGCACGTACTTAGAAATCGGCGTCCAGGGTGAACACCTGCTCCTCCGCCGCGACACCCACACCGGCC
TTGGAGTACTCGCCCACACGCTTCTCGAAGAAGTTGGTCTTGCCCTGCAGCGAGATCATGTCCATCCAGTCGAACGGGTTCTTCGCGTTGTAGATCTTCG
ACACGCCCAGCGAGTACAGCAGGCGGTCGGCCACGAACTCAATGTACTGGCACATCAGCGACGAGTTCATGCCGATCAGCTCCACAGGCAGCGAGTCGCG
CACGAACTCGTGCTCGATGGTCACGGCATCGCGCACGATCTCGTGCACGCGGCTCTCCGGCAGCTTGTTCACCAGCTTGGAGTACATGAGGCAAGCGAAG
TCCGTGTGCATGCCCTCATCGCGGCTGATCAGCTCGTTCGAGAAGCTCAGACCAGGCATCAGGCCGCGCTTCTTGAGCCAGAAGATGGAGCAGAACGAGC
CCGAGAAGAAGATGCCCTCCACAGCAGCGAACGCCAGCAGACGCTCCGGGTACGACGACACCCGCGGGTCGCACCACTTGAGCGCCCAGTGCGCTTTCTT
CTTGACACACGGGATCGTCTCGATGGCTCGCAGCAGGTGGTCCTTCTCCACCGCGTCCTTGATGTACGTGTCGATGAGCAGCGAGTACACCTCCGAGTGG
ATGTTCTCGATGGCGATCTGGAAACCGTAGAAGCAGCGCGCCTCCGGCACCTGCACCTCATTGCTGAAGTTCATGGCCAGGTTCTCGTTCACGATGCCGT
CGCTGGCAGCGAAGAAGGCCAGCACGTGCTTGATGAAGAACCGCTCGTTGTCCGTCAGGTTCGCCCAGTCCTTGAGGTCGTGCACCAGGTCCAGCTCCTC
GGCCGTCCAGAACGACGCCTCCGCCTTCTTGTACATCTGCCACACGTCGTGCTCCTGGATCGGGAACAGCACGAACCGGTTCGGGTTCTCCACCAGGAAC
GGCTCCGTCGGCAGCTCGCCGCTCACCTCCTTGCGCTTGAACTCGGACATCTCCAGCTTCGGCTGCTCCTCCTCCTGCTTCTCGTCCTTCACGTTCACGC
CCTTGACGAAGCCCTCCACGAACTGCGGGCTCAGCTCCTGCTCCGGCTGCTCCGGCGACTTGTCCGCCGCGGCGCGTTCCGACGAGGCTGCGACCATTGC
TGCGAGACGGGTGGGCGCGTTGATGAAGTAGAGAGGAGTCGAGTTGAGTCGCTTGCTGGGTCGAGCGCCAAATCCGGAATGACCAGCAATGGGGTCTACG
CTCTGTATGGGCAAAGGAAGCGAGGCAGAGCGAGCGCGCCAACAACGCCCAACTCGGTGCGCACTCCCGCGCTTTTTTCCTCAGTGAGCGGCCAGCCGGT
TTGAAATCGGGTTCGGGTCCTTTCAACACTCATCATCGTCGACACGAGTACTGTATGCTCATGTCCTGGTGTCCGCTCCTGNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCACCGAGGAAGATCCCTTCAATTCATATAGTTCATTTTTTTTTCTTATCGGAATCTGTGCGGCTTGGTG
AAGACGCGGTGGATATCATCGAAATAAAAAAGTTTGCAGTGAGCTTACTGCTAAGAGCTACTCGGATTGCGTATGTTATGACACGAGGAAATGGCTTTAC
GGTTTGCTTTGGTGTGCTATATCTATTTTACGCTAATGAAGCTTGCACATGCACGAAGACGGACACTTCCTATCGTGGCCGCCCCTGCACGGACTCTTTA
GCTTTACAACGGCTTCGGTGAGAGCTCGCTTGACTCTGCAGTTCTGGTTTACTTGGAGGCAGTGGGAGCCATGGACACCGAGTTCATAAAATCCATGTTC
AGGCCTTCATCGTCCTCATCGTCGAGGCCGTCAATGTCGATTATACTGCTTTCGCGGGGCTGCACGGACGAGCGTTCGCTGTACGCTCCAATGGAGCTAC
GGGTGAACTTGAAGTGCTTCTTCTCCGTCGTACGCGTTGGGCTGCCGGAAGAATCATCGCTGGCGGGTGGCTCGCTAGCAGGTTGCTCTTCGAGCTTCCG
TGCTTCTGAAGCATTCGAAGACGCTGTTGAAGACGCCACGAAAGAAGTAAAAGCTTCCTCCTCCTTCTCATCTTCACCCTCCACATCGTTGTACTCCACT
CCATGCGCCGCTGCGGCTGGTGCCGGCATAATAAATTCGTCAACCGAAGGAGGAGACGGCAGGTCGCTGCTAGAACTGGTCGATGATGCTCCGTCGCTGT
AGCGCAGCTCGGCCTTTTCCGAAACTTGTTTCGGCGTAAGCGACCTCTTTGGCTGAGGACGAGGAGGGCTGCGGCGCTGCTGCCTGTTGTCCACCTGCTT
CGTCGGACTCACGACCGGAGGTGTGTACTTCACGGTGCTGCCCACGAAGCGGCCTTCCTGATCAACAGGCATCGTGTTCGACACCGGGTGGTAGTTGATG
AAGTCCTTAACGTCCATCGTGTCGCGGATCTGCTCGTTCGTTGGCGAAGTACCAGCAGCGCCACCGGCGGCGCCGCTCCCTGCTACCATATCCGTCGTGA
GCCAGTCGCGGACGCCCGTGAAAGGGAAGCCGCTGCAAGTGGGGCACTTGGGCGTGGTAGTGAAGGTGTGCGAGGCGAGCATGGCGATGAAGCTGCGCAG
CGCCTTTTTGCGGTAGTTGATGACGACGGGCGTGACGCTCGTGAAGACGTGCTTGCGCGGGAACTCGAAGAGCTTGAGCACCTTCTCGTAGTTGCGGCAC
CCAGGGCACTTCTTGTCCGTGTTGGCGAAGAACTCGATCAGATCGTTGCGGAGCTTGAGGAACTCGGAGAAGCGGCGCGCGACCTCCCACACTTGGCCCG
AGCGGACGTTGACTACGCGCACATGGTAGCGCACTTTGCCGCCCTCGGTCGAGTTCACGGTCGGGATCTGCACGCGCACGAGGCACTTCTCGTCCACGCG
GCCCTGGTCGCCGTTGCGCGAGTAGGCGTAGCGCGACGAGGGGTTCATCGGCGGCTTCTTTCGGGAGGCGTGCCTTGGTCAGTGCACACCAGCAGGCTGG
AAGGCGAATGGCGCATGACAGCGAGATCGCGCCGTGAGCACGACCAGACGTCCGCTTCGCGTTCGTATGGAGCTCCTCGAGTAAGACGTCAGCGGTTGCA
GCTTTTGATTGGCGTTGGTCCCACCTTCCCCCTGACCCCTGGTTCAGAGAGCCAGAAGTGACTTGGTGTTTGTATGCCGCCAGCTGGGTGGAGCCGGTTC
AGGCCGAGCTTGTGTGGCTCGGCGTGTGACGCCACCGTTACGCAAAAATTGCACAGACGCTGAGGCTTTCGCCGCCCGCACAGAGCGCTTGGCTCGAAGG
CAGCTGGCCGCCGCATTAGCGGCAGTCAAGCAACGCTCGCGCCGTTGTACATGCACACATGTCCTACAGGAGAGCGCGCCTGCGCGACGCGCGCGATTTC
CGAGTCGTACGAGCTCGTGGCGATTGAGACCGATCGCGACTGCATGAGCCGCAAGCGCAGATGGACCGAGGTGGTTTCGAAGACACCCACGACAGCGCTG
CCTTAATTGATTCCGCGCAACCGCCGCGGATTGGAATGCTCCAGCGATGGATTTCCCGCCTTTAGTGTCACGCAGCGTTGTGTCCACGGCTGCTGGACTC
CATCTTCGTGACACCAGGTCCAGGCTAGGCTGCTATCCTCTGTGTTCCGGCGCTTCTGTACCAAGTCACCCCACAGTATCCAGCTTGCTTCAACCTCCTG
ATTGAAGCATTTGAAGCTGGCAGCCCCAACACATGGAGCGCGGACCGCGCTGCGCGGTGACGCGCGCCTAAGATCCAACGAAGCAGTAATGCCCCTGGGA
TGCTATTCATGACGAAATCGTGGTGAGACCCGGTTGAAGGACCCGCTAAGATCACCGATCCGACGGGATAAGTTCTGTTGGCTCAGTCTGAATCTTCAGA
GCCGAATCCGGGTAAGATGGTGCTGGCGTGCGGATGACAGCAAGCACTGGTAGCTCCGCCTGGCAGTGTTCAGTGTGGCACTTCTACGGCCCCAAAATTG
CAGCGCTCTCTCTGAGGTCTGACCGCTAGAGCAGATTCACTAACAACTAGAAAGCTGCAGACAATCGTCGCCGCTAAGCCGACATTTTTTTTGAACTTGT
CGAGCAGCGACCCGACAGTATCATTACGCAGGGAGAGACACAACCGATATATTTAACTGACAGCTCAATCTCCGGGTTGGATAGGCATGAATCGATGTGT
GTCCCCGTAGCACTCGCGCAATAAGGCGCCATTGAATTCAACCTAGCAGCTCCTCGAGTGAGTTGACCTTCACGAGATGTACGACACACGCAGTAGAATT
TACGGCTAGTATATGCTTACCGTAATTGATATTGTGGAAATCGATTAGATTGCCCGAGCGGATTAGCTGATAAAGCAGCGTTCATGAGAGATTTGACTGG
TACTAAATCGGGGATCCTTATGATTTCATATGGCATTGGTAAGGGTATAAATCGGTGTAAGGTTAATAAAATGGGGGTTGCCTCATTACCCGCCAGAAAT
ACGACGAGCGACCACTT