Description :
From Genome Similarity Track
Location :
Scaffold_34:438317- 440006
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G011040Similar to PEG10: Retrotransposon-derived protein PEG10 (Homo sapiens)

Sequence
1689 bases(100 bases per row)
GATCTTCTTCTTCTTCCAGTCAATGCTCGGTTGGTACCTTCTCAACCAGGGCATTCCCAGAATCAGATCAAACTTGTCATCGAGGTCGAGTGCTATAACT
CGTCTTCACCTCGGAAATCATCACATTCGATTGCCATACGCAACACGCGCTTAGGCATCGTCACTTTCGACCCATTCGCCAAGCGAACGATCATTTCCTT
GTTCGAGATAGGCAGGTCCAAACCTTGCCTTCTCACCACTTGTGTGCGGACAAAATTGTTCAACGCACCAGTGTCTACAAGAGCCCGTAGAGGTTCTGAG
TAACCATCTACCTTAACCTTGTGGACTATCAAGGTTGGCTCTTGCTCGACACGCTCACATCTGTTCGCGGAAACTTCATGTGCGTTACACACACCGGGGC
AAGAGTTCTGCGCTTCCGCGACATTCACAGAACTCTTAGTTCGCCCAGTAGGGAGCCCCGCTCCTACTGGTCGTTCCCGTTTTTTGGCTGTTGGGAACGC
TCAAATTGTCGGCCTCTGCCTGGTCGATTCGATCGCGGACCGTGCGTCGCTTGCTGGCTTGGCAAGGACACCTTGCAATTTCTCGCGACGTGGCCGGGCT
TGCCGCAACGGAAACACTTCCCGTCATTGCGTGGCTGTTGACTTGCAGTCACATCGGCATACGAGATGTCCATTGGCTCTGGGTCATTGTATGTTGTCGC
TTGTTGTCTTGGAGGTCGAGCGACAAAACCGCCGAACTTGGCTTGCTTGATGCTGAATTCTTCTTGCACCGCTCGCTCGATAGCTTCATCCAGCGTCTTG
GGGTACTCGCGGAACAACTGGTTCCGAATTGGACCATCATTGAGCCCTGCCATGAATGTCACAACTTGTGTTGAGGCATCAATCGGCTCATTCACGATAC
TTGACACAAGGTATCGTGCTCGTTGAGCGTACGAGTGTAGGTCGTATTTACCCTGACGAAGCTTTAAGAACTCTGCGCGAGCCCGAAATTCGCTCTGCGG
AGGTTCAAAAGCCTTCTTCAGCTCTCGCTTGAAGTCGTCCAGGTCGTAGAAGCAATGTGGCTCCGCCAATTGCTTCCCATACGCCCAACTTTTCGCTCGA
CCCGCAAGTTTTGACATTGCAAACAACACTTGCTGTATTGGGTCCCGTAGTTGTCTTGCAGTGATCGCTGCATCCAACTCAACGAACCATCTCGCTAGAG
GCTCGTTCTCTCCGCCACGGTGCGGAGATACATCGAGCTTCAGAGGTGCTACTCTCATCGTCGTGACAGGAGTTGCAGACTGTCGATGAGAGTTCATGAT
CTCGTGATGCATGAAACTCGTAGCCGCGTTCCTCTGCTCATCCGGTGACGCTGATTTCAGCAAGCTGATCACAGCCGCCTCACCGATGACCGCTCGCATA
CGCTCGAGGGCTGCCCACTCGTGGCTCGACAAATGAGGAAAATGCTCATTCGTCAGCTCCACGGTTTCTCCAGGCATCGAGCCCATCGGCGTCTCAATTC
CTTCCATTGTTTCTCACAATCGGACAGGGGTCTTGGAATGTCTGCGCACGCTACACAAGCGGCCTATGCAGACTCTTGACTTGGTCGTTGGAAGGACTAC
GAAGTGCTACCAGGTGTAAGAGGCTATCCGAGACAGCCTCAAACACAGCACACACGCTTGCGCTTGAGAGGAAGACTTGAGAGGAACTT