Description :
From Genome Similarity Track
Location :
Scaffold_227:43830- 48987
Transcript NameFunction/comments
Phypl_g5623hypothetical protein
Phypl_g5624hypothetical protein PHYSODRAFT_462850
Phypl_g5625hypothetical protein

Sequence
5157 bases(100 bases per row)
ATATAGAAGTTGATCAAGCTTTGGCGGTTATAGGGTGGGTACACATTTACCGTATTCCTTATGAAGAAAACTCCAAAACTGCAAAACCAGCATCCCGAGT
TTCTGATACTAAGAATCATCATAAGATTAGCGACGACTGTGCTGCCATTCTCGTACCGAACGAAGAGAGCAACACCGCACGAGGTAGGAAGTATCTATGC
TGCGGTAAATCTAGCGATGATATACATGTTCGGTCGTCAAATTTAGCCATACATTCGTGCGATAATAATACCAGTCCAATACCGGTTTATAAGctttaac
cctttcgcggtgCGAGGGCGCATTCTTCCGCTGTTACCAAAACACGGTGATAAATGACCTTCTAAACGGGCGCATTTTGCGCCCGTTTAGCTTTGTCCCG
TTCTCTACATACCGCGTATTATTACTACCAATCAGAGCAGTGAATGGCAGGGGGCTCGGGGTGGTTTTGGATGGTTCCATCTTCGAGCAGTATGTTATTG
CCTCACGGCCGTAATCGGCCGTAGCCACAAGGCCGCGTCATGGTCCAAGTGTGGCAAAAACGAGTATCGCCGTGGCAGCCAGTCACTTCACCATACGAAA
GGTAAGACACATGCACTCCACCTTGGTTTCCGTTTCACTATATCAAAATCAACAGAAATGCGCACAAGTTTCACTGACTCGGAAATtaagctgctggtgc
agatCGCCTTTCAGTTCGAGAGGGAGGGTCTGCGCATCACCTGGGACTATGTGGCCCGTCGGATGAAGACCAAGCGCGCTGGGCGAGAGCTCCGTCTCCG
GCTGGCCAGCCTCAAGGGAAGTACGGGAAGTCGATTAGCGGCTTCCCGCCTTGCTTTTTTAGTGGCCTGACTACGAGTCAGCTTCTAAGCGCGCCAGGGC
TACCGCCTCCGCTCCGCGTTTTTCCAGCGGCAAGTAACGCTAACCCGTTTGCCCCCACACGCCTCGGACGCACGTTCAAGGCCGGAGTGCGGGCGAGCGA
GCGTGAGATGGGCAGAACGACCGCAAAGAACATCCAGCAATCGTCACCTGCACAGCAGGACGATGAAAATGTTGGCGACGTCGGTGACACTGCCGGCCAG
GCAGTCGCCGACAATCGTCGAGGGCAAGGTGCCCGGCgaggccacgacgaccaggGAGCTGCAAGCGCGCGAAGAGCAACAGGTGTGGCTTGCTTTGTGG
CGCAGGTAGTGACAATGCTGTGGCTAATGTTCTAACTAATTGTGGGTTATGTTTGtgatgcaggagctggagactACAGCATGGGCACAGCCGACCACGC
AGCATCTGCCGGGCGTGGAGCGCGAGGGTGAGGTGCGCGCGGAGGGCGTGCAGCCCGGCGAGTTGCATGTGTTACAatcgcagcaggtgctgcttgTCCG
TTTTGTTGCTAATGCTGATGCCGTTTCTAACCTTGCGGTTGTTGATTGGGTATACGTAGATCTAGACTCAACCCAGGGCAAGCGGTGGAAACTGTAGCTT
CCATTTTTGAAGGTATCAGCGCGAACGATGTTCGCCAGCAAGCCGGTCATACCTATGTTAATACTACCGTCGGGTGTCTCGAAGATACTTGAAGCCGTCG
GGCCGTTCGAAGAAGCGGACGTTTTCCTCGACGTTGGAGCTGGCGTGGGAAACATTCTTGCCCAAGTTGCGCTTACGATGGACGTCAGAACGTGCATTGG
CGTGGAGCTTCGAAGGGATCTGGTCGCATTTGGACAGAGCTGTATACAACAACAGCTCAAGCACTACCCACGGCTTGGTaaggtgctgctcaagctggca
gATGTTCGAGATGTTTTGCTGTCAGGTCACCCTCCCATTTGTGAAGCCACCGTTATCTTTGCTAACACAATTCTATTTGAAGAAGATGCAAAGTTGGTGG
TTTCGCGAGAACTCAGCGCAATGCCAGTGGCACGCGTGATTGTCTCAACAGCGCAGTTTTGTCCAAGACATTGCTCCACGTGTGCGGAGCCATATTGCAA
GTGCTGGGACCTACAGCGCCATATAGAAATACGTTGTAGCTGGAAGTCAACATGTCATCCCATTTACATTTACCGTAAGAAACTACCTACGTTATTCAGC
TACCATTTAGATCGTCAGCGGCTCTGCTGCCAAGTCTGTGAGCAGCCTCGTCAAGTGCTTGAACAACATCACCGCAATGTCCctgagcagctccgctgcC
GAGAGCTGCCTCGCCACTGGGTCCGTGGTCCgtgccgccaccaccaagtacgtggacagcgctgctgtcgagagctgcgccgccaccgggTCCGTAAGCA
CTTCGGCGAGCAACTGCAGGTCGCTGTGCGCCTTCACGTCCAGGTTCATATATGTCCTTCAACTTGGCGAGTTTGGAGTGGCGCTGCACATTCCCTTTAT
CAGTAAACAGCTCATTGGGGCAGTAGAACTGGTGGAACTTATCCCAGCAtgttgacgtcgtcgacggacACATCCATGGCTTGGCGGGAAGGTCGTAAAC
GATCCGGCACAAACACACACCGTGGGTGAGGCAATAGTTTGTCACATCAGTCGGATATCTCCCCTCCCATCTACATACAAtacagcggcggcgcctcctg
ctcttctCTGCACGCATTTGTCTAGAAGACACTGACGTGCACGCAGTCGTCGCGAGCACAGCAGGTTTACCTAGAGGCCGCTGAGATGAAGGCGTGCCAA
CCTGCTCCACTTCTGCGTCGTCAAGCATTTCTCCACTGTAAAGCATGCGATCGTCACTGGGTGCGTTCCTCCATTGCCCGTTTAAAAGTTCTCCAACTAG
CTCCATCACAAATTTTCTATGCGGACCACGAATCGTCGGCTCTGATTTTACCAACCGCCGCGTAAGACACGCGTTAGATCTCGCCACATCGATTAGCGCG
AgggccagcttcttgtaTCAGCGTTTGTAGGAATGACCGTCCGCAATAGAGAATCGTCCTCATATTTGGTCCAGCCTATCGACGCCTTCCATGTTGGTGT
TGTACTGAGCGACGCATTCTGGGGCTGGAAAAGACTGTTTCCCGCTGCCAACCATGCGAGTTACAGTAGTAACATTTGTAGAGTCAGCATTAGAGACCAG
ATTGACAACATTTCCGTcgcaccacgacgctgctAGCATACTGTGGTCATGCGAGACAGCCTGGTGATAGTCTCCACGGGTACAGTCGTCCTTGTGTAAG
ATAGTGTGGGCTGGGTAGTGCTTGCTGTTTGCACGGATAGTGCCTCGACCATAGAGACCCTTCAACCGAAGCTCCTGAAGTAGCTGAACCGAGGTATAAT
AATTGTCCATGCTGACAATGCGGTTCGTTCCAAACAGTGGACTAGTCACCTCCAAAACATGGTGTCGGATTTTCGACacttcctccagctcctctcGCAA
GTTTTACGCTTCAACTTGATCCACCACACCACTCAGCCGATCCAAGATGTCGCTTCGATTGCAGTGAAGCTTGTAGTTCAACGCAACCCATGTCGTAGAG
CAGCACACCATGTCAAGCCGGAAATGGTATTTACCTGTCGGCTTCATGGGATTATACACAACCACatggcggccttggcgcgAGCGACAGGCAACGCTGG
CTTCATCGAGAGCAACATCTCGCCCTACGTGAATATACTGGCCGCCAGTAATCTTCGGCAACTTCAGGAGTGGTCGGATGCGAGTTGCCGCATCTTGGTC
TAGTGTGTTAGGAGTAGCATTGAAGCTCAgacagcgacgcagcagcttgaatCGATGCAGGGTCATGGTGCCGTCTAGCGATGTGGTAACGCCATCGAAA
ATTAGATCTTCGGCTTGTAGACCCCAGTAATTAGCGTTCTCGCCTTTGTCATTCatggccatgaagaagagaaTGCCTAGAAAAATCATCAGCTCTTCGA
GCGTGAATGGTGTCGCCATGCGTATGCTGTTCACCACAGCGTACTTGTTGGTCTCATGTAGAACTTGGCGCCAAATGTAGAGGGGCATATACGCGAAGAA
GCTTGAGCTGGCGGAAAGCTCAAACAAATGCTTGAACTCAGGACGCAAGTAGGTTTTGGTCGATCCGTCGCGGTGCTTGAACAGGTGTGAAGGTtcttca
acttcttctgACGGAATGAATCGCATGCTTCGGATAGCTTCAACCTCTGTCAGGCTAGTTGGAAATAACTCCGTGAGGTCGAAAGCCTCAAGcacctctt
cttcttctcaatCGAAATCTTCCTCCTCAAAGTCGATCTCCTCAGTAGGATCTGGCCGAACCAGTATCCGCCAATCCGGGTTCTTCATTCGTGTTAGCGC
AATGTAGTTCTCGATGCCAAGCTGCACAACTCCCACACTGATGTGCTCCACAGCGCTCTGGAACTGGCTGTCCAGCCAACGAATCTGGAAAAGCGAAGCG
TTCTTCCCTTTCTTAATTTGGCGATACACCCGGCCAATAATATAGCAGTACCAATAGGCCGGTAGGCCTTCGCTTTCATCCATCGCTCTTTGTCGGGCGA
GAACACAACAAACTTGTTCACGTAGACGTCCAACAGCATGATGGGCGGTGTGCGTGATGGCGtcgttgcagctgctgtggcccCAGTGGACGTTGCGCTC
CCCGGCTGCGGTGACTCAGGGATCGTGACTCCAGCAACCGGacctcggccaccacgaccagAGCCGAATGCCAGACCGACAGCTCCATCTACACCTGCTC
CATCCGCGTCACCAACATCACTGCCATgtgcaccagcttctgccTCACAACAAACACACGGTTAGCGTTCAGCTCTAGTACTTGCAGCCCCTAGTCGTGA
GACGCACCCGTAGTACTTGAGGCTCTTGCCGCCTGCCGAGGCGTACGCCCTTCGCGCCCCCCACGCGCACCACGCCCTTGTGCACCACGCCGGACGACGA
CTGCCCTATTGGCAGTGCCATCAAAGCTCTCTCCGACGTCGCCACCATCCTCACTGCTGCGTACAACTGCACCTACACAATAAACAACCACAAGGTTAAA
AACGACGTCACTGTTAGCAGTGTGGCGAGGCGCGTTGCCCAAAACCAGCAACAGACGTAGAACCTTTGTTACAGATCCGCTTCAGACCCGTTCAGCTCAG
ACGCTGGGCTGATGGGTCTGGACGAGGCGTGTGTACGCGCTCCTTGCAAATCCCTTG