Description :
From Genome Similarity Track
Location :
Scaffold_449:4383- 9664
Sequence
5281 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAACCCACGCGGTGATCACCACGGATGCTCGGTCCCAGGTGCAGGTTCACCGAGAGACGGCCGAG
AGACTCCAGCTTCGAGCCCAGCACCGCCAAGATGCGCTCCGACGACTCATCACATGCATCACGGACCAGCTGCTCAAGGGCGTCGCGACGCATAACTTGA
CCACGACCGCGCGAGTTGTCGGGAGCAGGCTGAGAAGAACCAGGAGACCCAGGGCGAGATGTTGCCGGGGTTCCCGAAGACTCGTGGCCACGCATAGCCT
CGATTAGTGGCTGCGGAGGCACGCCACCAGCCGACTGCAGATATAAGCAGACGCATCAACGAGAACAACGTCAGCACGAGTGAAAAGAAGGGAGACGCAT
GCAGAGACAGGTACGCACCTGTGCGGCATCGCCTGGACGCGGAGTACCGGCAGCCGTCGACCCAGCGCGAGCAGAAGACGACGACCGAGCAGGCGAAGAC
GCAGCAGAAGCCTGGCCGGAGAGGCCGCCACCAGAACTCGACGCAGTGGGAGCCTGCCGCCAGCAGAACAAGCGCACACGCGTGAGGGTGAGCAGTTGAC
GGCACGAGCAGGAGACCGAACGCAGCACGTACCATGTCAGCGGGATCGACGCCGAGCGCCCGGAACACGCGGGCCAGCGCAGCCTTCGCGGCGCGAGACG
ACCCAGCCGTGGTAGCGCGAAGACACCGGGAGCACCCTGACGCTCACCAAGTGCTGTGGCTCGCGACACGGTGTGGGCAGCTGTGGTGTCGAGAAAGTTG
AGTGAAGCTCACGGCAAGCCCCGCGGCATTCGGCGTCGACTCAACTGGCGGATCGAGGCACATCGCCATTCGTTCGATGGTGTTCGACGACCGCGGATTG
GCCAGTCTGGACAGATGACGATGACTCGTCGACACTCAAGCTCAAGCCGTGGTGTGTCCACACAACACCGGAACTTCAAGGACGACCCGAACCTACGGCG
AACTTTGGCCTGGGTTCCGCACCTAAGGCGACTCTTCGAGTCATCGGGAGGCCGTCCGAGCCTTCAAGAGAGTTCTGAAGAGTCGGGTGGTTACCGGGAA
GATCCACAACGGACACGTCTAGACTAGATATTTGTAGGAAAGAGAAGATAGAACAGATAAGCCCTTTGGGCAACAATGGCAGAACAGCTTTTCCTCCCAA
CCACTCAAGGAAGACGTCCGGGCTATCGGTGAGTTCCCGTAGCAATTGGATAAACCTGTTGGTAGGATTATGACTGTCGGTGGACGCGCCTGCTAGTATC
GTAGCGTGCGTTTACCCGTGGTCAGGCCAAGAGAAGAGAAGAGGTGGCCGTGTATACGAAGGGCGAGTCATCGCCGTGTAGTAGAGGAGCGAGAGCGCAC
TCCATTTATCCTTCCCGCCGGAGTATAGCTCCGGCACCCTCGTATCAAGCCGTGACTGGCTGGGATCCTTCCTTCCTGAGGGTCTGCGAGGTTTATATTG
TGTGTGAGAGCGTGCCAGCCTTTGCTCGTGGCTGGTGACGCTGGGTTTTCGTCAGTTGACTAAGCGGAAACACGGTGCACAGAGGAAACGTCAACCCGGT
GCAAGGGAAAGTTCCTGGGCCTTCAGGTTCTAACCCTAACAAGCCCATTGAGTCATCGGGACTTGGTGGGTGTTGTTGGTGGGGAAAGTGTGCTATTATA
TAATTTAGTGCGTGTTCCTACACGACGACTGGTGCCGCGACCCGGGATTGGTGTGACCTTCTGTGTCTCGTGCTACTGCAGGTCAACTGACTTTACGAGC
AACAACTGAGAAGAAGAGCAAGAAAAAGAACAAGAAGATGGCGAAAGGATCTCAATCGGCGGTACCAGCAACTCCGATGAAGTCCGGCGGAACGCGAGGC
GACGACTCGACGGCGGCCCTGATCACGCCGCAACTCGACCCGATTGCTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAACCGG
TATGAGATAGCGTGGATGACGTATGTAAACGGTACGAATGGCAGTCCGTAAAGCAACTTTGTTACGACACAACGACACCGGTTACAGCACCCTTAAAGAG
GCTTCCGCAACCTTAAAAACGGCTTGGCAACCCTAAAATTACTGGTTGCTTCAGCAACCGGTAATTTATCGAGGAGAAAATGACAATAGCGGCGTCAATT
TTGAGATCGATATTTGACGATCATACGGGCTGGCCTCAACACGCTAAGAGGAAGGAGCTGCACCGCATCAAGCGATACTATCACCACCACGACGCTATCC
GCCGTGGTTCAGCAGCCCGCCAGGTTCTACGGGCACCGCGTGCAACACGAAGTAGTCTTAGTTAAAAGGACCGCAAGTTCTGTGTCAGAAGGAGAGAGAT
GCAGGCGAAGGTCGGCGTAAAATAGTCGCAACTCAAGCAGCACATTTACCTGGTGCAAGCATGCCACTTGTTGGCGATGCGTTAGATCAAAAGTGCGAAG
CCAATCGGCCTCGAGCATGGGGCCATGGGCCAACAGAATTCATATTCATCACGCCAAGACATCGAGTATAGACAAGTGCAG