Description :
From Genome Similarity Track
Location :
Scaffold_1035:4383- 6752
Sequence
2369 bases(100 bases per row)
CACCTGAGTAGCCTCCTTAAGTGCAGAGCCTTTGCCGTGAGGCTTAGTGCTCTTGGCCTGCGCCTTACCGGCTGCAGCCTTGGAGCGTGTCTTAGCACCG
CTCTTAGCAGTGCCACGAGGCATGTTAACGGTCGAAGTGGAGACCTTAACGAAGAGCGCACAGGTTGCTGCTCGAGGCTCTAACTGTAAAGTGAGCCTCC
GCCGCGCTCGCGCGGCCGAGTCGATGGTTTTCGACTTTGAGAATGAGAGTTTGTGACGAACATCTCTTCATTCTGATTGGTCGGTAAACCGAACCTAAGT
GGGGGAGGATGTAACGGGGTACGTAGCACTAAGTGTACCCTGGTTACATGAAGTGTGACACTTCACACTTCAGGAGTATGACATGTCATACTCCGGGATA
TTTGGTACAAGGTACCAAGGTCATTCAAAACCAACCATTGGTTAAATGACATTGCATTTCTATAGGTAACTGATAGTTTGTATTAACCTCAAACTTAACC
TACCTATAAATATACTCAGTTTACAATCTACCTTATTTAGGTCACTTCGCTCTCTTTAATTAAAGAGGGGACCTGTGAACTGCCGTTCACTGAGAGTTTG
TATACTCTCGGAAGATAACTTCCTCTAGCGCAAGGTGCTGTGTGACCCCGTCACAACCGGGCAGCTGAGTTCACACAGGATGAAGCTACGGGGAAGTGGG
TCCGTCGCATCAAGTCGCGCGACTCTCCTTCAGAGCTTGTGGAGAAATTCTCGGGCTAACGCCTCTCTTCTCAGCTTCTCGCGTTACTGCAAGACGCTTA
TCTTGGGGCTGGTTCGAAGATTGCAACGAAAGCAACACCTCCGCTTCAAACCTCACATAGTTCCCTGAGATGAACAAAGGGTCTTTCCAAATAGGGTGAT
CGGGAAATTTCCTACGTAGCACTACCGAGTCTTGAAGAAACATTACTCTAAAAACGTGCAGCAATCCAATCAATCCTCCTACAGCAACTTCCCGGCTTCC
AGACTCGCGAAGGTCTCTCTCTGTCAAGAAAAACCTTTCGTAGTAGCTCAACAGGTGGGGTTATTGTGGCAAGATCTAGCCAATACCCACCCGCCTTTGT
CTGGAACCCTGCCAAAGCGCGCATTGCCTTTCGCGGTAGTGTTGTTAAATAGCACGCTTCCATTTCTCTCTCCATTCCATCTACCAGCTCGCCTAATCTG
GTTTTCATCCGCGCCTTGTAGCTCAGCCAGCTTGGATCCTGAGCCCGGATTGGCCAGCGTTCAGACTGACGAATCGATACCACATGCCCTAAATGCAGTC
TTCACGCTTTCTAATTGCGTATTGTACGCAATATCACACATTGCACCTTTTCGTTTTAGCAGACGGAGATCGTACTAGTGTTTTCGATCGGTAAAGCGAG
GAAATGACTCCAAATCCACATGCCATCTCCAGAACAAGTATAGGACCACCGCATTTAAAGGGCATAACATCACTTCTTTGCATCGCATAGCTTCAAGTTT
CGGCCTTTGACCCGTGCCTCTACATCAAAGTTGTTGATGGTCACTGTGTGCTCATACTGGTCTACGTCGACGATGCCATGGTCACCGGAAGCTCACCCGA
GCTGACCTCACGCACGAAGAGCGATCTTAAGACACGCTGACTCCACCCCTTTCGGGTTTCGGTATTCGGGTAAATCCATAGAGGGCGCTATCGATCAGGC
GTTGGTAGATCTGGGGCGCATTCTTCAATCCAAAAATGACTGACAGCGGCAAGTGTGTGCTCGTCTTTGGAATCGAATTGGAAGACGGCCCAGACGGCAG
CGTGACGATGAGCCAACGGCGTTATGTGGATGAAATCCTGAAGCGTTTGGGTATGGACGCGTGCAAGGCTGTGGTGAGTCCGGTGGATATAAGCGCTCGA
CTAGCTCCAAGAGACGCGGCGACCAAGGTACAAGCTCCGTTTCGCGAAGCTGTTGATGCACTAATACACCTGATGACCGCGACGCGTCCAGATATTGCGT
ACGCGGTGGGCTATGTGTCGCGCTTTATGGAGAATCCCCAAGAAGAACACTGGGTTGCGGTCAAGCGCATTTTTCGCGACCTGCAAGGCACCAAGACGCA
TGGATTCTGATACAAGTCGGGTGACAACATCGACTTTCGCGGATACTCTGACGCAGACTGGGTTGGTGACCTCGTGGACCGCAAGTCGACTTCCGGCTGC
ACGTTATACTGATGGGTGCGTCAGTGAGATGGGGTAGCAAGAAGCAGTCAAGTGTCTCGCTGTCTACGAGCGAAGCGGAGTACATAACGATCAGTCTAGC
AGTTCAAGAAGGCAAGTGGATCCTCTAGCGTGCTGTGCGAGATCTTAGCAGCTGCCAAGCCGATAAAGC