Description :
From Genome Similarity Track
Location :
Scaffold_1254:4383- 5948
Transcript NameFunction/comments
Phyta_totarag12530hypothetical protein

Sequence
1565 bases(100 bases per row)
TCCTCTACCTTTGATTGACGATTTGTTGATTGGGCTTGAGAGTGCAATGTGGTTACTGAGTTTGGATATGACTAGTGGTTTTTGGGCAGTGTCGATGACG
CTCCGAGCGAAACACATCTCAGCTTTCATTTGTCCGCCCGGTCATTTTCAGTGGACGCGTATGCCGTTTGGTCTGAAGAATGCACCCCTGATCTACCAGC
AGATACTCGACAACTGTCTCTGGGGATTCATGCGACTTTCGCCCAACGAGGAAGCTCAAGTGGACGCTGAAGTGCTGGATTTCTTGGGAATTGAGGCAGA
TACCTCAACTGACAGCGACAAAATGCCAGTGCTGTCTGAGGAGCTAACTGTTTTCCGAAGAAATATCCCAGCCCCACCTCAGCTGAATCCAGTCCTGGGA
AGAAGTTCCTACATCAATGATATCGCGTCTGGAGCTGAGACCTGGGGACATATGTGCATTGACCGAAATCGTTTGTTGTACCGACTACGCTACTGGGGCA
TTACGGTAAGCATACCCAAGAGCGAAttcggcaagaagacaaTTTCGTATTTATTTCATGAGATTGGAGCGGAAGGGATCCGAGCTAAGCCGAAGATCGC
GAAAGGTGTGCGGAACCTACCGTTCCCGTCAACTCTGAAAGGTGTGCAGTCATTCCTGGGAAGTCTGAACTATtacaacaagttcatcgaaGATCTTCCA
GTCGTGGCTTCAGTGCTGTACGAGTTGACCGACGAACAGATTCGTGCTGNNNNNNNNNNNNNNNNNTTCTGGGAGCTGGGATCACTCCAAGAGACCAGCT
CGACAAGGTAGCAGAGAACCTCATCCCAGCCTAAGGACGCGTTGTCCAAGCCTCACCGATTATCCTGGAGATCCTTGAAGCGGATTATGAAGGGTGGCTG
CTCAGTTTCAATGGAGCCGCCAAACTCTCAGATCGGCGAGGCAGTTCCGAATGTGTCTTGTGGAAACTACCGTCCTGGGACGTGATAGAAGTTCGAGGGT
TTCACTTTGAAGGTATCACAGTGAATGAGGCTGAGTATCATGGTCTAGTCGAAGGATGCCGGATGACGCTCGCTCGCGGGATCTCAGAACTGGTCGTAGT
GGGAGATTCTCGGGTTGTTATTCAGCAAGCCCAGAGTTTGATTCAATGTTTGAAGCCGGGGTTGCAGTTGCTACTCACCGAGTTCCAGAAGATCCAGCCA
AAGTTCCGATCGCTGAAACTTGTGCATGTGAAGCGTGAGTACAATCCCGCAGCAGATTACCTTACGACTAAGACGTTGATTGCTAGATTCCCAGTTATCA
TTGATGACCCGGTTGAATTGACTCAGCTGAAACAGCTGAACCGGATTCCtgagaagttgatgaagatggctgaCCCAGAACTCAAGGCACCCGAGACAGA
TCAGTCTGAGGAAAGTGAAGCCAGGGACGTTGTAGCAGAACCAATGTTGGTAGAAGCCGCAGCAGAACCAATGGCCTCGACTGCCAAGATCTTTGTAGTG
ACCCGGAACCAAGCTGGAACCAGAGTCACTGATGAAGGAATCGAGGAAGTCAACTCACTTCCGAG