Description :
From Genome Similarity Track
Location :
Scaffold_68:43829- 64727
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_68-snap-gene-0.30Elicitin protein SOJ3X
Pytve_DAOMBR484maker-pve_contig_68-fgenesh-gene-0.13Elicitin protein SOJ3X
Pytve_DAOMBR484maker-pve_contig_68-fgenesh-gene-0.14Regulator of nonsense transcripts 2
Pytve_DAOMBR484maker-pve_contig_68-snap-gene-0.33Mitochondrial Carrier (MC) Family
Pytve_DAOMBR484maker-pve_contig_68-snap-gene-0.21DUF726 domain protein
Pytve_DAOMBR484maker-pve_contig_68-fgenesh-gene-0.16Peptidylprolyl isomerase D
Pytve_DAOMBR484maker-pve_contig_68-fgenesh-gene-0.6ENSANGP00000010053
Pytve_DAOMBR484maker-pve_contig_68-snap-gene-0.23Sporangia induced parkin coregulated protein
Pytve_DAOMBR484maker-pve_contig_68-snap-gene-0.36Flagellar associated protein

Sequence
20898 bases(100 bases per row)
TGAAGCTCATCTCCGAGAATTGGCTGCGTCAAACACTCAACGGACCATGAAGTGGCGAAATCACCACGAGATGCATGGTCGCAGCGCCGGCTCCTTATCG
CGATCCTGGTCCTGGCAGCATCAGTCACGCGATGGCGAGCAGCGCTAGAACTCAAAGACCGCTTAGCACGCGTTGGCCGTGGTCGAGTCCGACGAGGAAG
TCGTGGTGACCTCCTCCGACGTGGAGGCCGACGAGGAAGTCGTGGTCGTCGTCGTGGTCGTCGCAGTCGTGGTCGACGGCGTCTCGGTCGCGGTGGTCGT
CGAGCCCGTCGAGGACGAGGTCGTCGACGTGGTCGTGGTCGACGTCGAGCCCGAGCTCGACAGCGACGAGCACACACCCGAGAAACCGTTCGCAAGCTCG
TACACGTTCACCTCAAGACCGCTCGTCGGCACAGTCAGCGTGCAATCAGGGGGGCTCAGCGAGATGATACTCTCGATGAGCGACTGGCAGTTCGTCGACG
CGCACATGAGAGCGTACTCAGCATCAGTCGGCAGCGAGGTCGAGTACAGGAGCGAGTAGCCCGAGTCGTCGACACATCCCTGGAACGAGTCGAGGGTCAG
GAGCGACGCGAGCGTCGTGTAGGCCGACGTCTGCTGCGACGTGGAGCAGTCATCAGCGGCGGCGAGGCCAGCAAGAGCGAGGGCGGCGACGGCGTAGAAC
GACTTCATGGTGGAGGGGAAGGTGGGCGGTTGGTACTTGCTCGAGTGAGGCTGAACTGAGTTGCGCAGAGCAAATTGGAGAATGAGCGAGGCTGAACTCC
TGTATTCGGAGGCCGGCCGTCCACGCTGGAGGACTGCAACGGACCTAATCGCAAAGAGGAGACTGCTCGACAGTTCAGCTTGCTGTGGAAGGGGATCCTA
GTGGTCGATCTGACAAGATTGAAGGCGTGCCCAGACTATCAGAGCAGACGCGAGCCCGGGACTCACTCGGCAACTTGGCAGCTCTGTGTGTCTTTGCCGG
TCTGCTTGAGCGCGTGCGGTTGAACTGGCCCACTCTGTTGACCGCCCTCCGTCTGGACCGTGCATTTCATCTCATGATCGGGCAGGAAAGAATGTATCCT
GCCGACCCTACCCGAGCGCCGGCCAGTTCGCCGTTGGCAACGCCAAGCCAATTTCGAGTGAGCAGACGCCAGCTTGAATTGATAGACCGCGCGCCGGACT
ATGCACGGCCGATCTCGTGTCGCACCGGGCCATTGCAGTTTCATCGCGTTGTCAGTGAAAATGGGCGAGCAATGGCAGGTCGCCGTCCTTGCTCAGCGGC
AACGAGCGAACCGCTAACACGACGAATTGAGATGAGGTCAATGATGGTCTGACTAGTGCTCGACTCACAGTCGGCGCGTGAGGAATTCCTTGGAATTGAG
CACGCGGAACAAGTTCCCACACTATCGAAGGCAAAATGCACTCACTCAGAATGCCATCTGTCTCCAGCAATTTGCTGTCATATGCAGCAATCCATGCGCA
GCAAACTCATTTCGTTGCAAACTGCGAACGTTCGCACCTTCAAACAGTGAAAACTCCGGAACACACAAAACTGAAAAATGGTGTACACGTATCGTGTTGG
CTCTCGGACACATCAAGTGTCCAGCGCTACAAACTGCTCAAAGTGCCTAGCTGGTGTGTCCGCGAGGCATCGATCAGCTGCAGCAAGCCGCTTAGCAGGC
CGTCGCGGTGGCCGTGGTCGCCGAGGGAGTCGCGGTCGTCGTCGACGGAGCCTCAGTCGTGGTCGACGTGGACGCCGAACCGGTCGACGACGCAGCCGTC
GTGGTCGTGGGGGCCGTCGTCGTGGTCGACGCCGAGCCCGAGCTCGACAGCGACGAGCACACACCCGAGAAACCGTTCGCAAGCTCGTACACGTTCACCT
CAAGACCGCTCGTCGGCACAGTCAACGTGCAGTCAGGGGGGCTCAGCGAGATGATGCTCGAGATGAGCGACTGGCAGTTCGTCGACGCGCACATGAGAGC
GTACTCCGAGTCCGACGGCAGCGAGGTCGAGTACAGGAGCGAGTAGCCCGAGTCGTCGACACATCCCTGGAACGAGTCGAGGGTCAGGAGCGACGCGAGC
GTCGTGTAGGCCGACGTCTGCTGCGACGTGGAGCACGTGTCGGCGGCGGCGAGGCCAAGCGTAAGAGCGGCGGCAGCGAAGAAGGCCTTCATGGTGCTGT
GAGGGTCGGCGAAGTAATTCGAGTCGAGTGAGGTGTGCGCGGCGAATTGAAGAATGCTCCGGAGCTGGCCGCTGGCTGTTCGACCGCTCTCGGCTCACAC
CCTATTGCTGGTGCGTTCGCGGGCCGCAGGGTCTTTGAGCGACGTCCAAGGCGAGAAATGCATCGCGGAGGTCGATGCGCTCGCTCCCGCCCGATCGACT
CCGGTGCACGCACGATCGTGGCTGACAGGAGGCTCATGTCCCCGGCGGCGTCTGCCAGCGTCGTCGTTGAAGCCGCCGCCTTCGTCCGAGCCGCCGCTGA
GTTCGCCTGGCTCGTGTGTAAGGCGCAGTTCAGCCTTTTGCGCGCGCAGAGAGTCGACAAGTGTATCCGCCGTCAGTGCAGAGAGCAAGGTCGCGCAGTG
CTGCACATCGAATTCGGCGCGACGCTCGATACGTATTATAATGGGATATCGATTTGTGTAGTCATTTGCGCAGTCTAACCAAAATCGAGCGATTCATTTA
TGAAGGGTATACAGTCGAAGCAGGTAGGAGAGACACTTGATTCGATGTCTTCGTGCTTCAGACCGCAGTGGGATCTCGAGATAGGCGCAGAGCGCAAAGG
GATCCTGCTGTCGGGCGAAAAGCACGCGACCTGCTCGACGCCGGGGTCGACCGACCAGGCCGCTGCATCCGACCCGATCTCCTGTCGCAGCACGGCGTGC
AGTTTCAGCTTCGAGTGTGGGCCTTCTGTTGGCACCCGAGAATGCTCGAGCGTCTGCGGGTATCATCGTTCAACAAGATGAAATCGTCTTTCTGACTGAC
GGCGCGCTGGTCACGGATTACCGCCGTTGAGATCGACTGAAAAAGCGTTGACGTGGCGGCCGACCGAGTCATCCCTGTGATCTTGGCAGTGCCACTGATG
TTAGGCACGGGCTTGAGCAATGTTCGAGACGAACGATAACATGGAGGTGGTGATCGAGCCATCCAAATCCACTTTTCAGCGGGAGACACAGCGTCTAGGT
TCCCTGCGAGACTCCGCGTCACGAATCGCTCGATCCGAGCGGTGGATGATCCACTGACTGTCAAAGACCTGAAGAAATACGAGGAGCAACATGATCTCCC
TGGCACAAGTGAACACGCGCACGCACGTACCGTCTCGAGTCTGGAGTCAATCGTGCACGATAAGACTTCAACACAGCAATACCAAACACAACAACCCTGA
ATCTGGCCAAAGCCGCAAGTTTGCATTGGATGTCGATGCATACGCGGTTTGCACCACGAACCTCAGCTCCATAACCTGGTGGTTGGCGCAATGCGATCAG
TCAGGTGTACCATCTCAGCAGGCGATCACGGTTTCGACGCGCGACAAGTGCCCAGCGCAGTCCAGTGGATGATGAACTTGGCCTCAACTTGGTCGATCAC
TGGTCAGATCATGGCAGCAGCGGAGCGTATAGCACTGCCTCGCAAGAACCAGAAAGCACATCGAGCTGTGCAGTTCGGTCATTTGCCAGCTCCAGCATCT
CCACCAAACTTTCCTCTGGGTGGCAGCGTCTCGTTGGAAAGCACAAGCAGCACGACGCTTTACTTGACGCCACGGTATCCTTTCCCGCGACGCAGTCCAA
ACTCAGCGTTGTTCCATTCCGACCCTCCACCGAAGCCCGCGCGACTCATGTCAGGCTCCTGAGTCGTGTACGACGCGCTAGGACGAGGCGGCGGAAACAC
TTGGGGTGCAGCTTCCGCCGTCGACCCCATGAGCTCGTCTCGCTCCATGTTCTGCAGCACCAGGCGCTTGAGTTCATTCTGCTCCTTCTTGCCGACACTC
TCTTGGCGGTGACTGTGCTGAGCCAGCGAGGACTCCTCGGGGACAACCAGGTGGCGCGCCTCCACTTTGCCCTTGTTGCCGCGACGCAACATGCGGAACA
CCACACCAGATTCGGCTCCATTGCCGCCGAACAGCATCCCCGCTGGACCCGCATGCGGCGGCGCAGTAGCGGCCTTGACAACGGTCGGAATCGCCATCTT
ATCGACGTTCACGCGAGTGGCGTGCTTCCGTGTCTCGCCGCTGTTTTGCATCATTGACTTGAACGCCTTTTCAAACGCCTCGTCTTCTTCGCTCTTCTGC
ACACGGTCGTGGATGATGAGCTGCTCCTCTTCCTCATCCTCTTCGTCGTCCTCCTCTTCGTCATCGTCATCGTCGTCCTCTTCGTCATCATCGTCGTCGT
CACCGTCATGTTCACGGTGACCGTCTTCGTCTTCTTCGTCGTCGTCATCGTCATCGTCGTCATCCCCCTCCGACTCGTCGTCCTCGTCCAAGAACTCTTC
TTCCTCGTCGGCAGGCTGTGACAGCGATTCGCCAGGCGAAGCGGCTGACTCGTTTATGGCAGAAGCCGCCAGCGCCAAATGATTCTTTTTCGCAAGTCGT
CGCTCCGCCTCATCCAACTCCGTAGCCAAAATGATCTGCGCAGCTGTGTCGGCGTCTTCCCACGTGTCGAACTTCGTGAAATGCTCCTTCAGTGAGCGCG
ACAGCGTGTCAAACAAATCGAACACGACAAAGTCGGTCTCCAGCGGGATCTCCGCCTTCGCGAACATGTACCGTTGGAAGAACGTCATAAAGCGACCAAG
GCGAGTTTTGGATAAAGATCGGTCGCCCCCCGACGTCGAGTTACCACCCATGCCGCTACCAGATCTGGAGTCAGCAGTAGCATTTCCGCCATTCGTACAC
CCTTCGATCAAGGCACACACCAGCCGGATTCGGAACACCTCGGTTGGACCATCAACGTCGCTCGGCACTCGAGGATCGTACCGTAAATCGGACACCAACT
GACATTGCTTTTTCATCTCCGTCACCTGATTCTCCGGAATTTGGCCATTCGAGTATTGTGCCAGCGTAAACAGATCGTGCGACTGGTTGATGAGCAGGTA
AAGCGTCTCCATGATCACATTCGTCGTGACCAACCCGCAGTTGAAGAGCTCACCCAGCAGTTTGATCAGTCCGAGGCTGCGTTGATGGTCGCGATAATCA
TTCACCTCAAGACCGCGACGAATCGCCTCCAGCACGTCATCAACTAGCAAAATGGCAAAGTCGTCGTGGTACCGCGACAACCCCTTGACGACCTCGCATA
CCCACTTCATGACCATCACCTTGTCATTCGTCACCTTGAGCACAGCCTTGAGCACCATCGCTCGCGTCGATTTTTCTTGCCACGGATACTTGCGCAGTGT
CTTGATCACCTTGTTTACGTTCGAGCCGTTCAAGTCCTTGTAGAGTAACTTCATCGTGAACATGTACAACGGGTCGTACTGCTTCACGACGCGCTCGACG
CGCTCAGGGGGTTTGCACATGTAGTACGCGTTCTCCACTAGTGTCTCCAGCTGTGGGTCAAGGTGCTTGGCTGACTTGAGCTTCATCATGGCGTTCAAGA
ACTTCTCCGTCCGGATGTGGGTGTGCTTTGAGCAATAAAGGAACCGCCCACAGTTCTCTAAAAACGCCGTGGCGACGTGCACATTGTGTCCCTGAAAGTC
CGCGAAGCACTTCTTCAAGCACCCAAAGCCCACGTTTGGAGGACAAATGCGGAACTTGACGAGTTCGGCCAGGAAGCGGATGTTCTTGATTTTGGACTCG
AGACGGAACTGGTTGCGCCTCTTGATCAAACCGTTGAACTCGCCGACCAGCAACTTGACAAGCTCATTACCGATATCGTCCTTGAGCACGCTCTGCAGAA
TCGCCACCAGACGCGCATAGTACCCCAGCAGCTCCAAGTGTGTGCGCGGGACGCTGAACAACGTCTTGATCAGTCGGTTTCGGCTTGCCTTGGAGTTCAT
ATAGCAGAAATCCACTGCTGCCTTGTCACATCGATCCCGGTTGACCATGTCTTCGAGCGAGCTAAAGAACGCATCCAGCTGATGATGATAGCTCGTCGAG
CCAGCACTCGCTGCCGTGGGAACCACCGCCTCTCCGCTCGTGGAGGTATCATGTGCTGGCTTGCCATCTCCATCGACGTGTTCGGGTTTTACCTCCATGT
CCGCTGCGACGGCGTTCGGTGCGTCACTCGTTGACACCGCCGGCTCGATATCACCGCTGCCACCCTCTTCTTCGTCGTCATCTTCATCGTCGACGTCGCC
TTCGGCATCAGCGTCCGCATCTTCTCCGCTTTCATCCACTGCTCCTTCCCCAACTTTGGTGTCGCGTTTCTTCTTCAACTCGGCTACCTCTGCTTCATTC
AGCCCAAGCACCACCGCTGGCACCAACTCAAGCAGATCCGGGAGATCCTCGTAGAATGCGCGCGTGTCCTCATCGTCAAACGGTCCATCCATCTGGAGCT
CCGCCCTAGACGCGTCCCCGCCTTCCCAGAGCGAGATGCCGCCGCGAGAGTCGTCATCCTTCTTCTCAAGCGGCAGTGCCGGCACATCTCGGTCAAGAGC
GTCTGCCAACGAATTGACACTGGTCTGGAGCTTGTCGAACAGCAGGCGGGCCTGGGTCAGCTCCTGCACGTGCTGCTCAGCCACCTCGCCGCGGTTCGCC
TCCTCTTTCTCGTTGCGTGCCTCGATCTTGACAAGAGTCGCGTGCTGCGCCAGGTAAAACTTGCAGATCATCTCAAACGCGTCCAGGAAGCTTGACAGAC
ACTCGGTCTGCACGCTCGGCGGTACCAGCACAGGTTCATCCTCCGCGAACGCCTGGAACTCCGGTGTGTCCCCCACGTGCTTCTCCATCTCCTTGAACTT
GCGGGACCGCACGCCGAGGAACTCCATCCCGACCGCCTTGGCGAAGCTCACGAGCAGCGGCACCTCCAGCTGCTGGGACGAGGACCCGCCACTGTTCGAA
GCTACCGACATGTTCCCCTTGGCGCGCGGCTTGCCGGCACCCTGCTCTCTGCGCGCGACGCGCTGCACGATCTGCGCCACCACGTGCACGTCGTCGAAGA
CGGCGGCCAGGTACAGTTCGCTCAGCAGCCGCAAAATGAGCCGCCGCTTGACCATCTTGGCGCGGTCGTCCGAGTTGTACGACGCCTCGAAGGCCGCCAC
CAGCGCCGCCACCAGCGCTGGTGCAAAGTCGGCGTACAGCTGGTGCAGCAGCGAGGCGACCCGCACGGTCGCACTCAAGTCGGCGGCCTTCAGCGGCGAC
TCGGTGAGCGCCGCGACGCACTCGCTCACATAACGAGTCAGGTTGAGCTCGCCCACGTCCTTGAGCACCGACTCGGCGCTCGCCTCGCTCAACACGCGCA
GCTTCTTGACGAACGCCGACGACTTCTTGATGTCCGCCTTGAGCCGCAGCTCGCCGCGCTGGATCTGCGCGCGCACCGCGGCCACGCGCTCCGGCGAGTT
CTGCGCGCGCAGCTCCTCCCGAGCGGCCCGCGCCGCCCGCAGCTCCGCCAGCAGCGCCAGCGCCTGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNATCGCTCGCCACCTGTTGGCTCGCTGCTTTCCTTCCACTTGGGCCGGGCAGGCAGGGGGCGGCAATAGTGCGCGTGGTGTGGCCCACGTCAGGAAC
GAGCTTGGTCGGGTTTCAGCGAATCGAGTCGCTCTATTCGCAACATTTTGTCCAATTACGGATGGCGTCATTCCTGACAATGGCTCTCGTCGAGCGTAAC
AGAAATAGCGGAAGGTCATGCGGAAATGTGATCGGAACCCACTGACCAGCGCGGAAGAGCAAGCAAAATGTGGCCGGAATGCATGGCCAAGAAGCATCTA
TAATATATATGTACAAGCCAGAGCGAGCGCCGACCGCAGACCGCACGAGCCGCTTGAACGCGCCGTCTTCTTCTCCCTCACTCAAAGTGCTCGATCTGCT
CGGAGCGCGGTTTCCGCGTCATGCGCTTGACGAACTCATAGGACGACACGACCAGCACGCCGGACGGACCCATGGACAGCAGACGCTGCGATTCAACACA
CTAGGTCAGTTGCAAGGACGCCGCCAGCTCCAACACAGCGACAACGTACCGCCGAGAGTCCCGTCATGAGACCGCGCGGACCATCCCGCTTCACGAGGTA
CTTGAGCGTGTCGATCGCGCCGTACTGCGTGTAGACCTGCGTCCGCGTGCGGACAATGTCCATCGGGTTGGTCAGTACGCCCGTGATGATGCCGGCGCTG
CCGCCGCTCATGGCCTGCGCCAGCACTGGACGATCGAGTGGTTGGATCGTTAGCTCAAAGGTGTGTCAATATCTGCCATCCTGCTCGATGCACGCCACGA
ACCTTGCTTCCAGAACGGGTCGGCGTTCCAGGACGACATGAAGTTGAAGTAGACGGGAACGAGCAGGCCGTACGAACCCCACCAAATGGACGACGACGGC
GCGTACGTGGCGATGGAGGGGAAGTAGCCGCGGTAGAAGCCGCGCAAGCCCTCGGCGCGGAAGACGCTCTTGGTGACCGCGAGGAACCCCTTGGCGCGCG
CGCGCGTCTTGCGCACGTCCACGCCCTGGTCGTTCAACATCATGCGCTGCGACACAATATCGAGCGGCACGACGACCGTCTGCGAGACGACGGACGCGAA
CGCGCCGCCGGCAAAGTTGGACAGCTTCTCGCCAATCTGCCACCGTCCATCCACACCTCGTCAGAGCCGCCCACATCCAAATCGACAGTCCCCACACACA
GAGAGCGAGCTGTCCATACCGTTGTGTGGTCGCGGAACATCTTGCGGGACTTCTCGTACACCGAGATGTACAGATTGCCCGTGAGCACGTTGGCCGTGGA
CGCGCCGAACCCCTTGTAGAGACCGCGCGGACCCTCCTGACGCAGGATCTTGCGGAACGCGTCGAACGTGCCGCTGTACACCGGACGCGCCTTGGACTGC
ACCTGCAGCCGCGTCTTGACCAGGCTGCTCGGGTACACGGCGGCGCGCACACCGAGGAACATGACCGGCCCGAGGATGTAGTAGCGCACCTTGTCGATCT
CGTCCCATGAAATGTCTTCGATGCCGCCGGCCGCGGGCGACGATGGCGGCGCCGCGCGCCTCGGCACGGCCTGGTGGCACTCCGGGTCGACCTCCTCCAG
CGTCATGGAGCTCATGGCGCTGGCCCAGACAGCGTCGGCGACGAGCTCCCCCTGCTTGCTGCTCCTGCGGTCGTGGGTGTGGCGAGCGTTTGCGTAAGAC
TCGCGCGTCCTATTTCTGGCCACATACACAGAATTAGGGGTCACCGTTAAACTGGCGGAAGTCACCCCACTAGGCGCTCCACATGTCCATTTGGAGCGCT
CCATAAGCAGCATCTCAGATCGAACCGGTATTGACTGCAGCACCGGTATTATTGCAGTTCTGAGCTCGAAAGTGGCTATAAACTTTCAAAGTGCGAATGC
CTTACATACTGAATATTCGTCATAATTCTTCCTAAAGTAATCGAAAACTACTGTTTGGATTTAGCCAACCTTTTCCATAGATTATAATCTCATCGGACGC
ATCCGAATACTATAGCACTTGACATGGGTGCGCGCACTGTTTTACCGAGGTTATGCTGAGATGGGGAGACGCGCCAACCCGGATTGTAGATGGTAAAAAT
ATCCAGAGCATCGGGCCATCATCGTCACAACCCAATATGGCCGACGCCGCGTCCGCTCGGCTGCTTGCGGACTGCCGCGCGCTCGGCCAGCGGCGCCGGC
TGGATGACGCCCAGCTCCGCGAGTGCGAGCAGCTGGTGCTGCAGATCCAGAGCGTCGGCAGTGGCGGCGGCGGCGAGGACAAGCTGCGCGAGCTGCGGGG
CCGCGTGCACGCGCTGCTGGACGCCGAGCTGGTCGCCGTCATCGACGGCGTGCGCGTCCTGCGGAACGAGCAGCAGCGGGAGAAGTTCGGCAACGCGGAG
CTGGCGGCTGTCGCGGTGGGCGGCGCGCTCGGTGCGCTGAACGCGTGGTTCCGGCCCGCGACACCAGCAGCTACAGCGACCGATGCCGCCGCGTCCAAGG
CGTCGGTGGCGACGTCGCTCTGGGCGAGCGCGTACGACGCGGCGGCCGCGTCGCTCAACGTGGTGCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNAGCACATGAGGGTGACGCACCTGAGCGGCGACCCGGCGAGCAGCGAGCACGTGCTGCTGTGCATCAACGGGTTCATGACGCAGAGCGAC
GACCCGAGCAAGAACTGGAGCGCGTGGTGCCGTGACCGCGCGCTCGGCGGCGAGGCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTGT
ACGCCGTGGAGTGGGAGGCCGGCGACGCCACGGTGTGGAGCGAGTTCGTCTCGCACGTGAACGACAAGCTGGTCGGCGCGCCGGCCGCGGCGGTGCTGAC
GCACTTCACGGGGAACCCGTGGCACAAGGCGCAGGCCAAGGCCGAGCACGTCGGCGTGCTGCTCGCGCACGTGCTGGCCCATCAGCCGGCGCTGCTGCAG
GGCCGCAAGCTGACGCTGCTGGGCCACTCGCTGGGCGGCGCCGTCATCTACAGCGCCTTCCAGGAACTCGCGCGGCTGCGGGCGGACCACCAGGACGGAG
CGTCGGAGCCGCCGGCCGTCGCGAACGCCGTCAGCTTTGCCGGCGCATTCCTGCCGACCGCGGACGGGCTGAGCAGCATTTCCCAAGGACTTGCGGCCGG
CGGCAAGTTCCTCAACGTGTTCTCGTCGCGAGACAGCGTGCTGTCGACGCTGTTCTGGGCCATCCACCGACCTGGCAACAACGACCCCGTAGCCGCCGGG
TGCCAGGCCATCCCGACACCGGAGAGTGGCGCGACACCGGTCATCAACATCGACGTGTCCGACCTGGTGCCTCCGAGCGTCGAGAACCACTTTGGCCACA
GCTACAGAGAGCGCATGGCGTCCATCCTCGCGCGTGTGCTTCCCCACCTCCACTAAAATCGATTTTCATTTACCAGCTACTACAGCGTGTGCTCGTCGTC
TCTCTGCTCGGTCGTGCGGCGGCATCGCCACCATCGGCAGCCGATCACCGCTTGTCGTTAAAGATGTTGCCGAACGCGCTCTTCTCCTTCTCCTTGGCCG
CGGCGTCGTACTCGCGCTTGAGCTGCTGCACGCGGCGCACCTCGCCGCGCACGGCCGCGTCCTTGGCGTCGACCTCGAGCAGCTCGCGCAGCAGCTCGAG
CGAGCGGTCGAAGTGCGAGAGCTGCGCGAGCGCTTGCGCCTTGCGGAACTGTGCCTTGCTGTGCTTGGAGTCGAGCGCGAGTACCTTGTCGCAGAACTCA
AGCGCCTTGTCCGGGTTCGTCCCCAGCTTGACGTGGCAGAACGCCATGTTGGACCAGACGGCCACCTTGAGCGCCTCGATCTCCGCCCCCTCCTCCGGCG
TCGCGCACAGGTTGACCGAGCCGGACGCGTACTGCGCCATGGCGTCGCCCGCCACCGACAGACCGTTCACGTACGCGAACACCTTGGCGTACACGGCCAG
CGCGCGTTTGAGCTCGCCGCGCTTGAAGCGCAGGTTGGCCTGCCGCTTGAGCGTCTCGGCCTGCAGGATCTTGTCGGCCACCGTCAGGTCGCCCATGCGG
GGCTTCCACGCCAGCAGCTCCTCGTCCGTCAGCTCCATCGCGCTTCTCGCCAAGGATTCGCCTTCCAGGAATGACACACAGCCTCGAGTTTAGCGCTGGC
TGTGTGCGGGCTGCTGACAATATTATAAAGTCATACTCTGCGATTTACTCGTGATCTCGGAGCGGTTAGCACGAAAGTAAATACCATGTATGCACTGTAC
GGCACAAAAACTCAGTATTGAATGTGGCTACATGATGATTTATCTCTCAAATTGAAGCAATTGTATTAAAATTAGACTGTACCCAAGACACTGAAGCTAT
AATTCGGATCCAGGAAGCTCGCAATGCCAAAGCTCAGCATCAACAGCGAACACCTGCAGCGCGCTGGTCGACGACCTGGAGATGGCCACCAAGGCGGAGA
AGGGGAATGATTCGAGCCGGGTGGACGCCGACTGCTGTAGCTGTCCCTCTCCACGAAGAACGGCCGATGGCTCACTGATCGCGGATATGGCGCCACTGAA
GAGGACGATATGGACGAGACCGGCTCGCTGCTGCGGCTCAGCGACCGCAGGATCTTGGCACGAGGATGACAAAGACTCAAATCGATCAGAATCATCGACC
TATGTCGAGACGACGACTTTGTCCTTCCGGCACAAGGAATCGCTGCAGCGTCATACCCAAGGCAAACTTCGAAGCGAGCAACTTTCGGATTTGGAAACAC
GATGGCATCGAGATACGCGAGCAGCGTCCTGAGCTCGCGCAATCTATTCGACTACAGCGATTGTATAACGGAGAGTATTGCATCGCGATTGTCTGCTTTG
TATGGCTCCTACCAAACGCAGTCTTTCCCATATGCGCGATCGATCATGGTTCTTGCGACTTCGCAACTGTCTACGATCTCAATGGTCGAGCGTTCAGCGT
GAAGGCCACGTATATTACTCCCATGCAGAGCTTTGATGCCATCGATGTCGTGCACCCCAGGTTTGCGTTAATGGATAACGAGAGCAAGAACAAGCACAAG
TCGAAGATTAGTGAGCGGAAGAAGATCAAAGGCGAAGAGAAGACGAAGTTTCATTGCCAGCGCTGTCGCCTTCGCAGATTCCTGCAATTCACGTATCGCC
ACGTAATACAGATGGTCAGTGAAGTGCTTTCACTAGCTCGCAAACTGCTTGGCAACGGACTGCACCCAAGCTCTTCTGCCCTCTTGCCAGACTTTTAAGA
TGATAAAGGGGTACGAGAAGGTCGTGGCTGAAGACAGCACGCATATGACTTCATCAGACAGAGGCAAGCAAGTACCTACTCAAGAAAAAGGGATAATGCG
TGAAATCCACACCTCGACAGCGAAAGTGAAGTTGGTGCAGTTGCACATCAAATACAAGACACAGCTGAGGTGCACGCTGGGACGTGTCGGCGGACGCTTG
ATCGAGTGCACTCAGAAGGGTACACGTCGAAGACCTGCTCCAGCTGCGGTAGGATCAACGACGGCCTCGGAGGCAGCAGCACATACAAGTGGTCACGCTC
TGCCACGTCGCGCACGATCGAGATCTTCCACAAGAGCATACAAATGCTCAGCTAGGGGTAGCCTAAGTGTCAATCGGTGATGCCTGCATCGAGAACCCCT
GTCACCACTAGCTGGCGTTGCAGGCCCACGGGCGAGTAGCGCCACGTTGCACCTTTGGTATCTTTCTGGTAGCTCTGAGGATCTCCGTGTTGGTGAAACT
AGCACAACTTCAACTTGGTCCGAACGCGCGCCGTTTCGTACCGTTCGATAAAATCTGTCCTAGCCCATTGCCAACTGTGCACATGTGTCTTTATGGACGG
GACACACCTCCGAACGTCATGGCTATGATCCGTTGCCGCCGCAACGCACCGCACCCCAACACGGCGAAGAGGCACCGAGGAGCGAGCGCAATTCGAGAGC
TCCACATTGCGATTGTCTTCTCTCCACCTGTATGGAGATCGACGATTTGTCCGAAGAGCTCTGCCTCGCGCAGCTCTGCTCGTTCCTGGCACTGAGCGAC
CGCTGGCGTGGCCTCGCGCGGGTCTCGCGGCGCTGGCGGCGACTCGCGCTGCTCTCGGCGCACACACAACATCACCTCGACCTGGTAGGGTCATCCTGAT
ACAAGTTGGATACGGTTCATGCACGCTGAGCCTCTCACGTTGTAGACATGGTGCACTCGAGAGCACGAGCTCGAAGTGGCGGCCAAGCAGCTGGCCCAGC
GACACCCGAGAGAGATCGCGTCGCAGCTCATCAGCATCGGACTGTACGGTCCACGAGTGACTGCTTCATTGCTCGACACGGTCGTACAGCGCGTTGGCAT
CGACAAGCTGCAGTGTGTGGCCATCGAGTCCAAGCAAGTCGACAGCGCGACTCTGAACCTCCTCGCGGCCTGCACTAGTCTCCGCCGCTTGACGCTCGAC
TGCATCAAGCTCACTGACGCGGCGCTTGTGGCAATTGCCAAGAGAGCTGGCAAGCTGCTGACGGCGGTCGACCTGTCTGGTTGTGCTCGGATCGGCGACG
ACGGCGTGGTGGCGCTTATCAAGCACGCGAATGCCTTACAGGAGCTCAAGCTCGCAATGTGCCACCGCGTCACAGATCGCGCTGTGATGGTGTTGGCCAG
TCGCCCGCCAAACTCGCTCATCAAGCTCAACGTCGACCGATGCATCAAGGTAATACTTCGTTCATGTTTCGAATCGACAACCAGTTGCGCCGACTGAGCT
CGAGATATTATTGTAGATCTCCGGTCCTGCGCTGTGCCTGCTTCTGCGCAAGCAGCGCGCGCTGCACCATCTTTCGTTCTCGCACTGTCCCAAAATCCAC
TCGAGCGATGTGCAGTGTCTCGTGTTGTCAAAGAGCCACAAGCCGGTGCCGACAGTGTGCAGCCTGATCGCACTCGACCTCAGCGGTTGCGCCGGCCTCG
ACGATGCGGCCATCGTGACGCTAGTGGGTTCCAACCGCGCGACGCTCCGAGAACTCAACACCAGCTCCTTGGTCTCCGCCTCGAGTCCGGCGTTCGCTGC
TGTCGCGCAATGCTCGGAGTTGTGCTGGCTCGACTTGAGCTTGTGTCGCGGTCTGCAGAACGCCGACTTGGAGCGCGTCGCAGCTGGGTGTCATCGCCTG
AAGACATTGCTGCTTCAAGGCTGCGTCTGCATCGATGACGCAGGTCTCCGAGCTTTCGCGCCGCTTGCGAGCTCGCTTGAGCGGTTGACGGTCGAGTTCT
GCTACAACATCACCGACGTGGGTTTCCAAGCGCTGGTGGAACATTGCCCGAGGCTCGTCAACTTGAACGTCACAGCGTGCAACCAGCTCACGGCCGCCGC
GTTCGAAGCGCTCGCTCGTCATGAGCGTCCCGAAGAGCACCGGTGGCGAATCGTTTACATTGGCGCGGTCGCCGACCTGGAGACGACGGCCGAGTACTGC
GCGATCATCAAGCGCTCCTTTCCGAGGTGCTGCGTGCACTGGGTGTGAGCAATCTGGCTCAACGCGGCGACTGTCAACTCTTCACAATTGTTTGTACTCC
TACCGAGGCATCAGCTGTATTCAAGTGGGCACACCATTCGACCTCCAAACCGATAAACAGTTGAAATATTCGTGCCGTGCCATGTCTGTCGTGTGCATCG
CTGTCCTATCGTTTTCGTCCTAGACTAGAGGCTCGCAGTCAAAAATAGGAGGTGGAGCTGTGCGCGCCGTCCTGAGTGGGTCAGATGACCCCGCATTCTT
GCTGCTGCTATTTTTGTGGCGGCGTTGCTCCCTGCAAGACCCGACACCTCGTGGCTTCCTCTCCATTTCGCGAAAGCAGAGCGAGCGAGGAGCGTGCACG
CGTCGGACTGTCAGCACCATGGCGGGCCGCATCCCGAACGTGAGCACGCGGATCGTGCCCAAGAGCATCACACTCCCCGAGACCGGGAGCTGCTTTGACA
CGACCGCTGTCGCCCCCAAGGTAGGCGATAGGCAACTCGACTGTGTCGTACAGCCTCCCAACTGACAACTGTAAATTCGGTCGCAGCGACGAGGGTCGGA
CGAAAAGACGGACGATTCGCAGCACATCAGCGCCTTCTCCGTCTCGAAACTGTCCAAGCCGCACACGACCGACAAGTACCTTCGAAAGGGTCAAGGGATC
GGCGGCACCGTCGACTTGGACAAACCCGCGAAGGTGTGTTCGATTCCAGCTCGTGCTGGGTCGAGTCGGAGACTGACACCGTGTGATTGTGCGCAGTCGG
ACAAGCAAGAGAACCTCTCGCCGCGCAAGCAGCCGGCCGCCTTCCGAGAGCGTTCCAATCCGCCAGACACGTCGTTCAGACGGTGAGCAGCCTGGCTGAC
AGTTCGAGCTAAACCTGCGATCGGGTTGGATCTCAATCACCGCGTGTGCTTGCTGAGAACAGCTTCTATGAGCGCGGCGACCTGCCGATCCAGATTGATC
ACGGCGGCACCCGTAACATGGTCGCATGGAAGGTCGACATCACCAAGGTATGCGAGAGGCGCCAACCAGTATTTCACTCGCTGTCGGTTTCATTGACATG
TTCTCTCGCTGCTACAGCTGGACTTTCACCACTACCTCCCCATCTTCTTCGACGGCTTACGCGAAGTCGAGGAGCCGTACGCGTTCCTGTCGGAGCAGGG
TGCCAAGGACATGCTCATCAACGGCAGCTCCAAGGTGCTCCCGGTCATCCCGCAGCTCATTATCCCGATCAAGAGTGCGTTTCGCGAGTTGACCTTCTCG
GACAGGCACGGACACTAATCGTATCTTCGCCTGATAGACGCGCTGAACACCAGGAATGCCACCATCATCGTCAAGACGCTGCACATGCTGCAGCTCATGG
TCACGTGCGAGGCGGCAGCCAATCCCGGCAGCGGTCCGGGACTCATTGGACAAGCGCTCGTGCCGTACTACCGGCAGATTCTGCCGGTGCTCAACATTTT
CATCCGCAAGAACGGTGCGAGCTGTTGATGGTCACGTTTGAAGCCCCGATACTGATATAGTCGTTCGTGAGCAGACAACATCGGCGACTCGATCGACTAC
AGCCAGCGCAAGCAGCTCAACCTGGGCGACCTGATCCAGCAGACGCTCGAGATCCTTGAGGTTCACGGCGGCGACGACGCCTTCATCAACATCAAGTACC
TCGTGCCGACCTACCAGAGCGTCTGTGTCGGCTAAGTCGCCTCGGTCGAGCCACTTCCCAGTCCGTGTACGCTTTAATTGCTTTCATAAGGACAAATATG
AGCCTGCGGCTTAAAAGAATCAACCAGCAACACGAAGTCGTCCACCCTTTCCCCACTTCGGGTATCATATTCGCTATCGCCGCTGCTCCCACGACGGGCG
AGGGACTGGTCCTGCCGTCGACGGCCGCTTTGATGTCGCTGCGGCCGCCNNNNNNNNNNNNNNNNNNNNNNNNTTCGGTCGAACAAGTCCCGGTTTCGCT
CGTGCCGTCAGATTACAGAAGCCTTTCGGTGCCTCCTCCCTCTCGTCACCTCCGATCTCGATTGCAACACCAAACACCTCTGGTCGCGCGCTCAAGAATG
GCCGCGCGTCGACACTGCTCTCGTCTGTTGTGGACACGTCGGGGTTGTTGGCTCCTCGACCATCGACAGAGCGACGGTGGAGCTGGTTCTCCTGCCGTTT
GACTTGCCGCTCGAGCTCCTTGTTTTGTTTCTTGAGCACATTCACCTCGCTCATGAGCGTCGCGTTCTGGAAAGAGAGCGCGGACGCGAGCTTGGACTTT
TCCTGGTGAGCCGCCTCGAGCTGCCGACGCTGGTGCTGTTTGTCCTTGAGCAAAAATGTCGTCTGTCGGTGCAGCTCCGCGTTCACGTCCTCGGACCCAT
CATCGCGAGCTTGGAGCGCAGTCAGCTGGCGCGCGAGCCGCTTGTGGATGCGGACGATCTCGCCCACCAGCGCATTCTTCTCCTGGACGGCGCTCTTCTT
GACCAGCTCTCCCAGCTCCTCTTGCAACACGACGATCGAGTGGCGAGTCTTGTCGAGCTGTCGCTGCGCCGCAGCCACCTCGCGCTCATGCTTCTTCGCC
TTGAGCGCAGTCTCCTCCCGGAAACGGTCGCTCAGGTTGGCCTGGACGACGATCTCCTGGTTGGCATCGTGCAATTGTCCCACGTACTGCTGCATCTTGT
CGAGCTCCTGCTCTTTCGGGATCAAATGCCGCTGCAAAATCTCGATCTGCGAGCGGTGCACGCTGTCCAGCCGCTGCAGGTTCTCGAACTGACCCTTCAG
CTCCGCGTACTTGGCCAGCGCGTCGTGCCGGTCCTTCGCCGCCGCCTCCGAGCTGCGTCGCTCGTCCTGCATCTTGTGCAGCAGCGCGTCGATCTCCTGC
GCCTTGCGATCGCACTCACTGCTTGCGAGCTGCAACTCGTGATCCTTGGCTGCCAGAGCCGCTAGCAGCATCTTGATCTCCTGGCTGAGCGCCGCGAGCT
TGCCGTGCGCCGCGGACTGCTGGTCCACCGCCTTCCTCTTCTCGACCTCGATCGAACCCGACAGCATCAGCACCTGCTCGGCCTGGTCTTGGTGCTGTTG
TCGCAGGACTTCCTCCAGCTTTCGGTTGGCGAGCGTCAGTTCACCTTGGAGACTGCTCTTCTCCGCTTCAAATCGCCGCTGCTGAGTGTGGAGCTTAGCT
TCGTATCCTTCTGCTAGACGATCTTCGTGATCTTGTGCTGTCTTCAACGCCTCCGCCATCTCCATCCGCAGCGCGACCAGCGCTTCTCGCAGTGTGTCGC
ACTCGCGCTGCAGCTTCTCTGTGTTGATCAGGTAGTGATCCTGCGCCGCGCGAGCGTCCGCCGTCAGTGCCTCCAAGCGGCTCTCGCGCTCGCAGACTGC
GCCTTCCATCCGCGCGTCCAGCTCGAAACGCAGTCGTTGCTTCGCGTCCTCGGCCTGCTCATGGGCCGTCGCGACCTCGCGCTTGACTGTGGCTTCGAAC
CGCGCGCGCTGTTCGCCGCCCTGCCGCGCCAGCATCTCGTTCTCGAGCCGGAGTTGTTGCAGCTCGCCCTCCACGTCCATCGCCTTGAGCCGCGCGAGCT
CGATCTTGCTGCGGTCGTAGTAGCCGATCTCGTCGGCCTGGCAGATGCTCGTGAACCCCGTGCTCAACTCCAGGTACATTGGCTCGGTCCCGTCCTCAAG
CAGTCCCGCGAGGTGCTTCGCGGTCTCGGAAGGCTCGGGTGCCGTCTGACACGGATCCGCCGCCACGGCGCACGCCAACACCGCGCCGCTGGAAGCGTTC
GACATCAGCGTTCGCGTCTGGTCAACAAAGAACAGCCCTGAGACTGCGGACGTATGCACGTCGACCACTCGGATAGCAGACGAGAGCACAATCGTTCGGC
GTCCATCGTGGTCAAGCTTGCCACGCTTCCAGCTGAAGATGGCGACTGCTCCGAGACCTGTTCCCGCGAACAGCAAGTTCGGTGACCCGCCGGTGCCGGT
TAGAGCGGTGATGTCGAGCGAGATTCGCTCTCCGACATGGCCACCTCGTCCTCGAAGCACTTCGTGTCCGAGCTCTCCGTTCATCCAACAGCGAAGCAGA
CTCGCAGGCGATGATGCTCCAGCGGCTACCGCCTTCTCGGCAGCNNNNNNNNNNNNNNNNNNNNNNCACGACGTAGTCGTGACCGTCGCGGTCGATTCGG
CACGCCGCCATGCAGAGGATGCTGCTTCCTGGAGTCTGCACCTGCGCGACGCTCTGCACCTTGACGAGCTCCTCGACCTCGCCCCCGGCCTCCCAGCGCA
GCACGCAGTGGCGCACTTCGCCTGCCGCGTCCGCCACGAAGAAGCTGTTGTCGTGTGGAGCCCACGCGAGCTGTGTGAGCGCCGCGTGGAAATCGCGGCT
GGCGACACCGACAAGCTGCGGCGCGCGCTGCGCTCGCGTGCACGACTGGTAGACGTAGACGGTCTTGTTGGCCGTGTGCACGCCGGCGAACAGACTGCCG
CTCGAACTGTACTTTACGACGCTGATCTGCTTCTGCGCGAGCTCGAAGCCGAGGCGCACCGAGTCCTGCAGCACGAAGAAGATCTGCAGCTTGGCGCTGA
AGGACACGAGCAGCTCCGAGCCGTGCGGGTGCAGGTCGAGGCTCAGCGGTGCCGACGCCTGCTCGAACGTGTGCGTGAGGTAGCACTCGTGCGCATCCGC
CTGGTTCCACACGTTGACGGCGTACTCTTCGCCTGGGAGCTGGCAGCTCGCTGCAAAGCACGCGCGTCGGGACGCCGCGCTCAGGTGGTCCATGCTGGTC
GAGAGCGGCGTTGACGCCATCGCGTTCAGCGTCACCACCTGCAGGTGCAGTCAAGTAAACACACGTGAGATGGCCGCGGAGATCGTTGGCCGGCTGCGAA
CGACGGAGCGGCCATACTTCGTCATCACCTCGCAAGAGACACAGGTCGCTCAGGTCGTACACGCCGTAGTTGCGCTCTGTGCAGCAGAGCAGCACGGCGG
CCGCCGGGTCCGTGCCGAGTCCCAAGATGTGCTCGCTGCGGTCAGTTCACGTGCGTTAGTCAGTGCACAATAGACAAAACGAGCGGAGGGCAGAGGCGTA
CGCGTCGCGGACGTGGATCCGCCGCTGGAAGTGCAGCTCCTTCTCGTCCGTCTTCATCATCTTGGCGGCCACGCGGATGACAGACACGAGGCCGTGCGAG
CCACCGACCACGACGCCCTCGCCGTTGCTGAGCGCCGCCATGCACGCGAGCCGGCCCATACCGCTGTGCACGCTGCGCAGCGTCTGCACGAGCTCGGCGT
TGACGATCAGCTGCACGTCGCCGTCCTCGAGCAGCGCGACGAGGCAGTCGTTGGGCAACCAGACGTGATCGGCGTAGCTCACGACGCGCTTGAGCTTGGT
CTCGTCGCCCGACTTGAAGCTCGCAAACGGCCGCAGTGAGTACTCGGCAAGCGTCCAGAGGCGCAGCATGTTGCCGCCGCTCGTCGAGAGCTGCGCCATG
TCGATCACGTTGAACCGCGCGCGCGTCACCTTGCAGTGCACGTCGATGCTCGCGATCTGGCGAGCGCGACCCCAGTCCCACACCACAAGTGTCCATGCAG
GTGTGGCACTCTGACAGCACACGAGTTTGCCGTCGGGCGACAATGCTGTGCTCACGAACCGCTCGGCGTCGAACCCGAGCGTCTTGAGCCACGTCCCGCG
CTGGTGCGGCCTCGAGGACCGAACGGTTTTCACCACCACAATGTCCGTTGCACTCCCGCCTTCCGTTCGGCCGACCGACGGCGCAGAGCTGACCTTGT