Description :
From Genome Similarity Track
Location :
contig_22:438234- 459153
Transcript NameFunction/comments
g4788.t1hypothetical protein
g4789.t1putative elicitin protein RAM2D
g4790.t1putative elicitin protein RAM2D
g4791.t1putative elicitin protein RAM5
g4792.t1hypothetical protein
g4793.t1hypothetical protein PHYSODRAFT_517693
g4794.t1hypothetical protein PPTG_09082
g4795.t1hypothetical protein PHYSODRAFT_516298
g4796.t1hypothetical protein PHYSODRAFT_516289
g4797.t1hypothetical protein

Sequence
20919 bases(100 bases per row)
CAGTCTTGCTCGCTCCCTATATCTCAGAGCGTGTGAGCGCGGCCAGACTCGCTCAGGTAGACGAAAGCACTTGGCCGCCACGCCGAACGCACTACACGTA
CCAATGGTACTCAGTACTATGACATCCTCGAAGATCAGCTGTACGAGGGTATCCGGTGATACCAGCGTCAGAAGCTGTGTTCTCGAGTTCGACGCCATCT
TGAAAACCTATTGAAGCTATTGGTACAATGCTGGACGTCAATAGACACCAAACAGTTTCCCAAGCACTGCACCGGACCAGACCTCTCTGAAGCATTCCGG
GATTGGCCATCGATATGTGCCGAATTGCGCATTTTGCTTCAGAAACCATATTGTGAGAGTGTTACGATCCACCGCAGGGACAGCTCAACGGCAGCAATTC
GCTGCATGTGCCAGGTCGATTGCAAGCGCTGCCGTCTCCTCATTCTACAATTTCCTCCGCTTCACGCAGACGACTAGACACCCCAGCCTCCAGGTACTCA
CCATGAACGCGCAGACCATCCTCGCCGTTGCCGCCATCGTTCTCGTCGGCTCGGCCGCCGCCTCCAGCTCCTCCAGCTCCGACGCCTGCTCCACGACGCA
GCAGACCTCCGCCTACACGACACTGGCCAGCCTGCTCACCCTCGACTCGTTCCAGGGTTGCGTCGACGACTCCGGCTACAGTCTCCTGTACTCCACCTCG
TTGCCCACGGACGCCGAGTACGCGCTCATGTGCGCGTCGAGCGACTGCCAGTCGCTCATCGAGTCCATCATTTCGCTGAACCCGCCTGACTGCACCCTGG
ACGTGCCAACTAGCGGTCTCGAGGTGAACGTGTACGAGCTGGCGAACGGCTTCTCGAGCATTTGTTCGTCGCTGTCGAGTGACTCGTCGACCAGCACAAG
CTCCACCACGACCACCACCGCGACGTCCACGGCTGCCAGCACGAGCACGGACACGACTTCGACCACGACGACTGCCACCACGACCACCTCGTCGGCTGCG
ACGTCGACGGCTGCTTCGACGGCCAGTGACGCCACCACTTCGTCCAACTCGACGGAAACCGCAGCGACGGCGTCGAGCTCGGACTCCACGGCTACGACTA
CCACGGCTACGGCCTGCTAAACAAGAGGCGCTTGCTTAGCTTGGCGTCTTCTGGCATGAGCTTCTCTTTTGCGGTATGCAACGGACTCCGTAGCACGTAG
TCTGGACGCGCAGGTAATTTGTACGGAGTGAACGCTAGCATTGTCGTCTCCGGCAGTGTCCAAAATATATCAAGCAGTGCCGTGTATGTGATGCGCGTTC
CTTCTACCTGAACAGCGCATAAATTCACAGATAAAGAATGCGCACAGGACTGAGTAGGCCAACCCCTCCGCCCAGTGGGGTGAGCGGATGTCCCGATGTG
TATCGTGATAAGGACACCTGCGACTGTGACGAATTGCCTTGAGAACAACGGTAGAACCTTTTGGTCGAGTTGCCTGTGGCTGGTATCCAGGACACGAACT
TGCAACAAGGACCAGGAGGTATGGTATCCAAATGAGTTTATTATGATGGGGTGGGCGATCGACCAAGAGTCGACACCTCGTCCAAAAGACGATATATACG
AGGCTAGGCTGGCAAGAAGCGGCGCTCGCTCCCTCACCCACGAGAGACTAAGCGACAGCTTCCATTCGCAACAACTTAGCAAGCGATGGCAGTCTGCGTC
GTCGACGTCGTCGAGTTCGAGGTGGTGGCAGCCGGCGTGACAGCAGGGGTCTCCGTCGTGGCAGCAGATGCCTCCGTCGTCGTCGTGGTCGTCGGCGCCG
TCGTGGCAGCAGGGGCGGCCGTCGTCGCGGCAGGCGCCTCCGTGGCCGTGGCAGCGCTAGAGGCCGTCGACGTCGTCGTCGTCGAGGACGAAGAGCACTT
GCTCGAGAAACCGCTCACCAGGTCGTACACGTTGAGCACCAGTCCGCTCGTGGGCACCGTCAGGTCGCAGTCAGGCGGGTTCAGCGCGGCCACCGACTCA
ATGAGCGACTGGCAGTTGTCCGACGCGCACATCTCCACGTACTGGGCGTCGTCCGGCAGCGACGTCGAGTACAGCAGGCTGAAGCCAGAGTCGTCCGAGC
AGCCCTGGAACGAGCTCAGCGTCAGCACGCTGGCCAGCGTCGAGTACGCGGTCGTCTGCTCGGTCGACGAGCACGTTTCGGCGGCGACAGAGCCAACGAA
GGCGGCGGCGGCAACGGCGAGGACGGTCTTGGTGTTCATGGTACCTGGTTGGCGGGTGTGTTTGGGGAGGAGGCTAGTTGGCTGTGTGTCTGAAACAGAG
CAAGTTGTAGAATGAGACGTTGCATGTCGGTGTGGCGGCCGCTTGGTGTCCGAACTGCAGCCGGGTCTGACGCTCACTCGGACGGCAAACTTGCACGACC
CAGACCCCCCACCTGATACTGGCACGGACGTCCGATCTCTTTGAACCAGTCTGTGGCTGGGTTTGGCTGGCTGAAGCGGACGCGAGGCGTATCTTTGGAG
GACGACTGGTGTTGCACATCTGTCAGAAGGTGGGACTCATGAGCGTTGCACACGCTCGAGCGGATACACTGCCCAATCTACTGGATTTGCCATACCCAAA
CAACGCTAGTTTGGGTGTCGATGTGCAGAGCATGGGCGGATCACTTCAACCAGGCGTAGTTTGGGCTCCTTCACAGTGTCCTCAATGAAACTGCGGATCT
GAGATCAGATATCCATAGGGTTGCCACCACTGCTGACGCAGACTTTTGGAGAAAATCTGCCACAGCAAAAGTCTGTTGCTGTGGCCGATGGGCAGCCTTG
TTAATGTAATCCGCTACCTGTAGGTGTACAGGCAGCGGATTTCGGCTGCAAGGTTTTTACAATGTTCAGCGGCGAAGCTTTTGGATTGCAGCGCTACTTA
TGTAAATTACGCTGCCCTCATTACACAGCCTATCAGACCAGGTCTAGCGTCGTCAGATTCGAGAATGGCCCAAGCGAAACTGCGCTTGGGACACGCGCTG
ACCTGGATCCCCGTGTCACGGTGAGTCCTAATGTAGCGCTTCAAGCCGCTTTGATTGGCGTCGTGCTCTACACTGGCGGGCGAGACCAGCAAACTTTCTT
TCATATCTCTGGCGTTCTTCCACAATCCTGGATCGAAAGTAGCAGGCAAGGCAAAGGTCTTGCACAATAGTGTGCGCAGACACCAATGCATCCCGGCATA
GTTAGATATTAAAAAAGACAGGTCGCAATGGATGAATGAAGTCGTGCTCGCGGCGTTAACTAAGTGTACAGTGTCCCAACAAACTTTGGGAAGCTAGTTG
CTGCCAGCAACACGCCAGGCAGCTTCAGCTGCCTGTCCGACGCATCGCCGCAGACTGCCCTACCACAATCCGGACAGATCCTTCCTGTTCGAAGCCTTTG
ACCTCAGTTCGGACACCGAGCTTGACGCCGCCACACCGGACATGCAACGTCTCATTCTACAACTTGCTCTGTTTCAGACACACAGCCAACTAGCCTCCTC
CCCAAACACACCCGCCAACCAGGTACCATGAACACCAAGACCGTCCTCGCCGTTGCCGCCGCCGCCTTCGTTGGCTCTGTCGCCGCCGAAACGTGCTCGT
CGACCGAGCAGACGACCGCGTACTCGACGCTGGCCAGCGTGCTGACGCTGAGCTCGTTCCAGGGCTGCTCGGACGACTCTGGCTTCAGCCTGCTGTACTC
GACGTCGCTGCCGGACGACGCCCAGTACGTGGAGATGTGCGCGTCGGACAACTGCCAGTCGCTCATTGAGTCGGTGGCCGCGCTGAACCCGCCTGACTGC
GACCTGACGGTGCCCACGAGCGGACTGGTGCTCAACGTGTACGACCTGGTGAGCGGTTTCTCGGCAAGTGCTCTTCGTCCTCGACGACGACGACGACGTC
GACGGCCTCTAGCGCTGCCACGGCCACGGAGGCGCCTGCCGCGACGACGGCCGCCCTGCTGCCACGACGGCGCCGACGACCACGACGACCACGACGACGG
AGGCACCTGCTGCCACGACGGAGACCCCTGCTGTCACGCCGGCTGCCACCACCTCGAACTCGACGACGTCGACGACGCAGACTGCCATCGCTTGCTAATC
ATCATCATCTTTGCATTCTGTGCTGAGTGGTGAATGCAGAGGTAGATATGGTAAATAAGAAACGTCTCATTATTGTTTTTTGTTGCTCGGCTTGATGTCG
TGTGTTTCAAAAACGAATAGCACACGAAAAACCAAGCGTGGTAGCATGAATCCTGTGTACAGTGGCGGCTTCGTGTTGCATAGGAACTTCCTATACGTAC
TATTAGGAAGTACAGTACTAATAGTGTCTTCATTGCATCTGTGCAAGACTACACGTATCTACAGCTGCTGCAGGATGTAGCTATTGCATGTGCATCGCGC
TCTCAGCGATGCAAACCTTGGCAGCAAATGAGGTGAAGCCTTCACTGTTTTGGTGACGAAGTACTCGCTGCAGGATGCAGGGCGTTTGCAGTGGATTCTC
TCACATCTGCATGATGTAGCATGGGCGTGCCGACGCCGCCGTCCGCTATTGGTATCAGCAGTCTACGGTGACACTCCGCTGACGTTGAGGCTCGTTACTC
ACCTGCAGACGCGTGCGGGATCTGCTTTGGGACACGTGAAGCGGATACACCTGCCCGGCTCTGCCTGCAACTCCAGGATTCACTTTTCACCGCACGGGCC
TGTAACTTGGAGGCTGCAACACGCGGGATCACTCGGAGCTGCAAAGCCGGAACGCGTAAGCCTGCAAATTACCAGCAAGTGGTGCTTTCAACCGCTTATG
TCGACCACAACCAGAGGTTTTTACCTCCTCTTTCGGTTCTGCCGCCATGACGAGGTTGATCTCCTTTCCCTTTCCTTGTCCACCGTGGCGCGGCAGTATC
GCGCTGTCCGAAAGTTCCACTCGGCCGCTGTTCGAACAGCAGCAGCCTTGAGCCGCAGGCCTCACCTCAACCAGCTCATTCTGCAATTGGCCTTCCGCAT
CTCACTCCATCCTCTCCACCCCACCACAAGATGAACACGTACTTCGCTGTCGCTGCCGCCGCCCTGGCCTTTGTGGCCTCCGTGAACGGTGAGGCCTGCT
CGGCCTCCCAGCAGGCCAGCGCCTACACGTCCATGGTGAGTCTGCTGCAGGGCACGGCCCTCAACACGTGTGCCTCGGACTCGGGCTACAACATGCTGTA
CGCCACGGCGCTGCCGACGGCCGAGCAGACCGCCGCCATGTGCAAGGTGGACGCGTGCCACGAGCTCATCAAGAACGTCCAGGCTACCAACCCGCCTGAC
TGCGACCTGAGCATCCCACGAGCGGCGCCGTCATGAACGTCAAGAGCCTGGCCGACAACTTCGAGCCTGGCTGCACGTCCTCGGCCGCCACCGAGGGCCG
CCACCGAGGCCCCCGCCGCCACCGAGGCCCCCGCCGCCACCACCGCTGCGCCTTCCACCGAGACGACAGCCCCGGCCGCCACCACCGCTGCGCCGACTTC
GGAGACGACTGCTCCGACCGCCACCACCGCTGCGCCTTCATCGGAGACGACTGCCCCCGTTGTCACCCCGGCTGCCACCACCACCGCCCCCACCGCGTGT
TAAGAGGCTTCTTAGCGCTCGGTGCCTGGCAAGCCGCTTGCTAGGACCCAGCAACGATGCGTCGTACCGCTACCGCCGTTAATAAGAGGCACTCGTGCCC
ATTTGTGTTATAATCTGCTGCTGTTGCCTTTCGAGTTGACCGGTGCTGTGTATCGACAATGGTGAGAATGTTCGAACAGCAAAAACCGATGTGTATTGGA
TTCACAGATCCCGGCGACCGGGAAAGCACCGCATCATGCGCTGCCACTTCTACCAGCGCAGTATTCATGTATTGAAACCCACAAGACAAACGTGACGCGC
TACATGTACAGTAGTATTATAGCAAGACCGTCCTATTTGAACTGTAGGGAGCTGGTGAGGTTCAAGCCACCGTCCAACGTTTGCTCCGTGTTCTTGCCCT
CTTCGCGTCCAAGAGCTCAAAGCTCCTCAGACCACTTACCTACTGCGCTTCCTCCAGCATCGCACCGTCCTGGATTGGATCAGATAGGCGAGGAGCAATT
CGCCTCGCACGGTTGGCTCCGTCCAGCACATCTTCATCGTACTCGTCCCTCCTACAATAGCCACCAGGGCTTGCTTCGCTTGCAGCAACTTCTTAGCTGT
CACGCTTCCACTGCATGGCAGTGAGCCGTAGCAATTCTCCAACCTCGATGTGCGGGCCACGCAGTATTTCACTGCTCGTCTCTTGTCGCCGGTAGATCCA
AGATCCCGTGAACCGATAATTGTGGTGCCACTACTTCGCACCACGATATCCTTTGCCTCGACGAAGCCCGAACTCGGCGTTGTTCCACTCGCTACCGCCT
CCAAAGCCTATGCGGGCCTCATTTCCCTGCTGCTGCCCGGTCCCTTGATTGCCGTAGGTCGCGCTGGCACGCGGCGGAGGGACGAAGCTGGGAGCGCCTT
CAATGGGAGGCTCGTCGCTCATAAAATCATCGCGCTCCATGTTCTGCAACACGAGACGCTTCAATTCGGACTGCTCCTTCTTTCCAGCGTTCTCCTGGCG
GTGGCTGTGCTGAGCTAGTGATGACGCCTCGGGCACCACCAATTGGCGCGCCTCCACCTTGCCCTTGTTACCACGGCGCAGCATGCGAAACACCACACCA
TCAGCGGACCCATTTGCATCATGGGACAACATGCCACGGGGCCCGCAGGGGTAAGTGAAGCCGAGCTTTTCACAACGGCTGGAATAGCCATCTTGTCCAC
ATTTACGCGTGACGCAGGCTTGCGTGTGTCGGTAGACCCATGCATCATCGACTTGAACGCCTTTTCAAAATCTTCGTCCTCCTCACTCTTCTGAACGCGG
TCGTGGATGACAAGGTGTTCTTCTTCGTCTTCATCGTCTTCCTCCTCATCGTCTTCTTCTTCGTCGTCATCGTCATCCTCCTCATCGTCGTCGTCCTCTT
CCTCAGCATCATCACCTCCTGCTTGATCGTCTTCATCATGCTCATCTTCGTCATCGTCGTCGTCGTCCGAATCGTCCTCCTCGTCTTCGAGGAATTCATC
TTCATCGTCGCACGGCTGCGAGAGGGACTCCTCCGCTACAGTCTCCAGACCATTGGTGGCCATTAGCAGCGCCGCATTCTTCTTTGATAGGCGACGCTCA
GCTTCTTCCAAATCGCCACGAAGAATTTCCTGGACGGCTAGGTCAACCTCCTCCCACGTTTCAAACTTTTTGAAATGGTCCTTCAAACTGCTGGCAAGCA
TCTCAAAGAGATCGAAAACAACGAAATCGGTTTCCATGGGCACCTCTGTCTTGGAGAATAGGTATCGCTGGAAAAAGGTCATGAATCGACCGAGCCGGGG
TCTGGAGATGCCTCTCTCATTTGAACTGCCATTGTTTCCAGACATGCTCGGACTTCCGCTGCCATTGCAGGTCTCGATCAAGGCACTTGCCAGACGAACG
CGAAAACACTTCACTCGGGCCATCCACCTCACTTGGCACGCGAGGGTCGTACTGCATATCGGGAACCAGCAAGAATCGCTTCTTCATTTCCAACAATTGA
ACCGGCGATATTTTATCACTACTGTATTGCGGCAGTGTCAGTAAGTCGTGCGAGTGATTGATCAGGAGGTACAGCGTTTCCACCACCACATTCATACTCA
CGAGGCCGCAGTTGTAAATCTCTCCTAAGAGTTTAACGTATCCGAGGCTTCGTTGATGATCGCGGTAGTCATTGACTTCCAGTCCGTACCGAATATACTC
CAGCACGTCGTCTACCAAAATCACCAGTATCTCATCGTGATATCGCGACAGCCCCTTCACCACATCACAGATCCATTTCATTTGCATCACCTTGCCCTTT
GTCACCTTCAGCAAGGCCTTCAGGACCATCCCGCAGGTTGTACTCTCCTGCCATGGCAACCGACGGAGAGTCTTCACAACCTTGTTGATGTTGGAGCTGT
TGAGGTCTTGGTACAGCACCTTGATCAAGAACAAGTACAGCGGGTCGTACTGCTTCACTTGGCGCTCCACACGCTCGGGAGGCTTGCACATGTAGTACGC
ATTTTCCACGAGTGTCTCCAGCTGCGGGTCCAAATGCTTCGCTGCTTTCAGCTTCATCATGACATTCAAGCAGTTCACCGTGCGTACATGTGTATGCTTC
GAACAGTACAGGAATCGACCGCAGTTTTCGAGGAACGTCGTAGCCACATGGACGTTGTGGCCCTGGAAATCCTGAAAACACTTTTGTAGGCAACGAAAGC
CTGTGTTGGGCGGGCAGATCCGGAACTTCACCAACTCGGCTAGAAACGGATGTTCTTGATCTTGGATTCAAGACGGAACTGGTTGCGCCTTTTGATCAGG
CCATGGAATTCGCCCACAAGCATGCCCACAAGCTCACCACCGATATCTTCCTTTAGTACGCTTTGCAACGTGGCCACTAGACGCGCGTAGTGGGATAACA
GTTCCAAGTGGGTGCGTGGCACCGCATACAGCGTCTTCACCAGACGATTTCTCGATGCCTTGGAGTTGCGGTAGCAGAACTCCACCGCTGCCTTATCACA
GCGGTCGCGATTGACCAAATCTTCCAGCGAGGCGAAGTACGCATCCAGTTGATGGTGGTAGCTGTTCGTTGCACCGCTCGACGAAGTTGTGGCACTATCA
CCTACACTGGTATCATCCCTTTCGTCCTTGCTCTTGCTCTCCTCCTCCTCAGCGTCAGGCGCGGCAGGGTCCTTACCTGCATCTGCTTCCAGATCTTCCA
TTGTAGCGTCTCGGTCTCTTTTCCGTCCTCATCGGCATTGACGTCAGCTTCCTCCTCCATCTCTGCTTCTGTCTCTTCTTCTCCTGCTGCAGCGGCTTCT
TTCTTCTTCTTGAGCTCGGCAACATCAGCTTCCGTGAGTCCTAAACAACTGCAGGCACCAACTCCAGCAGGTCGGGTAGGTCTTCGTAAAATGAGCGCGT
CGCCTCATCATCGAAAGGCCCATCGCGGCTCAGCTCACGGCCGCCACCTTCCCCGCCTTCCCACACGAGAATACCTCCACGACCTGAACCGTCGTCCTTC
TCCTCCACAGGGAGCGGCGGGACGTCACGATCCAGCGCGTCTGCCAGCGAGTTGACGCTCGTCTGCAGCTTCTCAAACAGCAGCTTGGCATTCTTGAGTT
CCTGCACGTGTTCGTCCGTCACTTCTCCGCGATTGGCCTCCTCCTTCTCGTTCCGCGCGTCCAGCTTCAAGAACGTGGCGTGCTGCGCCAAGTAAAACTT
GCAGACCATATCGTACGCGTCGAGATAGCAGGCGAGACACTCGTCCTGCACAGCCTTGGGCACCACGGGCGTCTGCGAGTCCACAAACTCCTGCAGCTCG
TCCGTTCCTTCCAGCACCTTGTACATCTCCTTGAACTTCTTGGGCTGCACGCCGAGAAAGTCGACGCCTGCCGACTTGGCGAAGCTCACAAGCAGCGGCA
CTTCCAGCTGCTGCGATGTGCCCGCACTGTTCACGCTCATGTTGCCTCTGCTTTTGCTCCTGGAGCCTGGCTGCTCGCGCCTTGCGACGCGCTGGATGAT
GTGCGCGACCACCTGCACGTCGTCCAGGACGCCGGCCAGGCACAGTTCGCACAGCAGCCGCAGGATGAGGCGGCGCTTGAGCATCTTGCTCTTATCGTCT
GAGGCGTACGAGGCCTCGAAGCTGCCCACGAGCGCGCGCGCCATGCCCGGCGCAAAGTCCTCGTAGCGCTGGTGCAGCCGCGACGCCACCGTGACGGCGG
CCGACAGGTCCGCCAGCTTGAGCGGCGCGTCGGCCAGTGCCGCCACGCACTCGCTCACGTAGCGCGTGAGGTTGAGCTCGGCGGCGTCGCGCAGCAGCGA
CTCGGCGTTGGCCTCGCTCAGCATGCGCAGCTTCTTGACGAAGGCCGACGAGCGCTTGATGTCCGACTTGAGCTTGAGACGCGATAGCTGCTCACGCACG
GCCGCCACCCTGGCCGTGCAGTTGGCGGCGCGGAGCGCGTCGCGCATGCTCTGTCGCTGGAGCTCCTGCAGCTGCGCACGGGCCTCTTCGTCGTCGTCGC
GCGCCATGGGCCGGAGGTGGCTCTTTGGGTCGTCTTTCTTGGGGAGTTGATCGGATTCGAGAGGGATGCGGTGGACCACATAATTAGAAGGTGGACACTG
GAGGACGTTAAAAAGGTCTATTGTTTAAGACGAATCTAGTGTAGATACTGTATAGCGAGTTGTTACGCGTCGGAGTCGGGCTCTTGCGGTTTCCGGCACA
CGCGCTTGACGAATTCGTACGACGTGACCATGAGGATGCCCGACGGACCCATAGCCAGTAGCCGCTGCAACAACAACAACAAGGCAAGGAGTTAGCGACT
GCAACGTGCCGTTTTGTACAGGGACGTGAGCGCACCGCAGAGAGGCCCTTCATGAGCCCCATGGGGCCATCGGTCTTTAAAATATACTTGAGGGTGTCCA
TGGCGCCGTACTGCGTATACACCTGCGCCTTTGTCCGCACGATGTCCATGGGGTTCGTCAAGATGCCGGTGATGATGCCGGCGCTCCCTCCGCTCATTCC
CTGCGCCACCACTGCAACAAACCAACAACCATGAGTCAAAGTGCCCAATCACCCACTCTCTTCTTCCTCTGCACCTTGTTTCCAGAACGGATCCGTCGGC
CATTCCTTCATCAACCGATAGTACACGGGCACGAGCAGCCCGTAGGACCCCCACCAAATGGACGAGGACGGCGCGTACGTCGCGATGGACGGCACGTAGC
CCTTGTAGAACCCGCGCAGACCCTCCGTGCGGAACACTTGCTTGGTCACGTTCATGAAGCCTTTGGCGCGCTCGCGCGTCTTGCGCACGTCCTGCCCCTG
TCCGCTGAGCATCATGCGCTGCGACACAATGTCCAGCGGCACCACGACCGTCTGCGAGACGAGCGACGCGCACGCGCCGCCCGCGAAGTTGGCCCACTTG
TCCCCCATCTACCAATAATAACAATACATTAGCACTGCAGTGCACAACTGCCCAGCCCAGTGACGGCCGCGCACCGTCGTGTGGTCCCTGAAGACCTTGC
GCGACTTCTCGTACACGGACATGTAGAGGTTCCCCGTGAGCACGTTGGCCGTACTGGCCCCGAAGCCCTTGTACAGACCGCGCGCGCCCTCCTGGCGGAA
GATGGTGGCGAACGCGTTGGCCGTGCCCGAGTAGAGCGGCTTGCGCTTGGACTGCACCTGCAGCCGCGTCTTGACCAGATTGCTCGGGTACACGGCGGCG
CGCACGGCCAGGAACATGGTGGGGCCCAGCACGTAGTATTTGAGCTTGTCGATCTCGTCCCACGAAATGTCCTCCAGCGCGTACTCGTCCTCCGACATGG
TGGCCACCCCGCTCATAGCTCGGGCTGAAGCGAAGACTGAAGTTTGAGGCGGAACGCCGCTGCTGATTTCAGCCAATGAAAACGATTGACATGTTAAATG
CCAGACATACTGAAACCAAGTCAAGGATTGATGACTGCCTTTTTATCAAAGATCAAGATGGCGGACGTGAGCGATGAGGAGCTGCTGGGCGGCTGGAAGC
CCCGCATGGGGATGCTGTCCGTGGCCGAGAAGGTGGAGCAGGCGGAGCTGCTCAAGCGCCAGGGCAACCTGCTGGTCAAACAGAGTGAGTTCAAGCGCGC
ATTGGCGTCGTACGCCAAGGTCTTCGCGTACATGAACGTTTGTCCGTGGCGGGCGACGCCATGTCCCAGTACGCGCAGGCGTCGGCCGGCATGAGCGCCA
CGCAGGAGCAGGGCGAGCAGATCCAGGCCGTCAAGGTGGCCGTGTGGGCCAACATGGCCCTGTGCCACCTGAAGCGCGCGACGCCGGATAAGGCCCTGGC
CACGTGCGACAAGGTGCTGGCGCTCGAGCCACAGCACAGCAAGGCGCGCTTCCGCAAGGCACAGGCCATGGTGCAGCTGGCTCACTACGAGCGAGCGCAC
AAGCTGCTGTGCGAGCTGCTGGAGGACGAGCCTAAGAATGCCGCCGTGCGCGGCGAGATCCGCGCGCTGCAGGCCAAGAAGCGCGCGTACGACGCCGAGG
CCCGGGCCAAGGAGAAGAGCGCGTTCGGCAACATGTTCAAGTAGATCAGGAAGGAGCAGGACCAATTGCAGACTCAAATGCAGATATCTCGTAGTTAGGC
TGCTTGGCTGTTCTGGTCGTCTACAGTCGCAGGAGGTGCGGCAGCACGCGACACTTGATGGCCGACATGAACTGCGCGTAGCCGTGGCCGAAGTGGTTCT
CCACGCTCGGGACCACGAGGTCCGATACGTCGACGTTCACGCAGCTAGTAGCGGCGGCGAAGGCCAGAGCTTGGCAGCCCGCGGCCGCCGGGCCGTTCGG
GCCCGGCAGTTGCAGCGCCCAGAAGAGCTTGGACAGCACGCCGTCACGCACCGAAAACACGTTCATGAACTTGCCGCCGCTCGGGTCCAGGGCACTCGTG
ATGTTCTCCAGCCCTTGCGCATCTGGGATGAACGCGCCGGCGAAGCTGACGGCGTTGGCGATCAGTGGCAAGTTGTCTCTCTCTTCTCCGCGCGTAGCTT
GGCCATCTCCTGAAGGCGCTGTAGATGACCGCACCGCCCAGCGAGTGACCCAATAGCGAGATCTTGCGTTCCCGCAGCAGCGTCGGACGCTCGGCCAGCA
CATGAGCGAGCAGCACGCCCACCTGCTCCGCCTTACCCTGCGCACTGTGCCACGGGTTGCCTGTAAAGTGAGCGACCATGGACGACACGGACGAGCTACC
AAGGTTATCGTTCACGTGCGCGCAGAAGTCGTTCCAAGCGGCGGCGTCACCGGCCTCCCACTCCACGGCGAAGACCGCGGCGTCCTCGTTCTCCTGGGTC
CACGCACGCCAGTTGCGCGTGGGGTCGTCGCCCTGCGTCATGAAGCCGTTGATGCAGAGCACCACGTGGCCACAGGTGGCTACGTCTCCGCTGAGCAGCT
TGAGCTGCAGTTGCTGCACGCGGCGCTTGCGCTTGGCTACGTTGAGCGTCGCCATGGCGCCGTCGTACGCGCTGGCCCACAACGTCGGGGTCGTGGTCGT
GGCCGTCGGCGCGGGCGCGGCCGCAGCCAGGCGTTCAAAGCGCCTAAGGCGCCGCCCACCGCTACCGCCGCAAGCTCTGCGTTACCGATAGTCTCCTGTT
CCTGTTCATTCGACTGCAGCCGCACGCGCTCCACGATGGCGTCCGCTTCTTGGACCAGCAGCGACGACACGCGCTCACGGAGGGAGTCGGCCGGACTCGT
CTCGTACTCCTGAAGTTGTTCGGCCGACAACAGGCCGCGCCGCTGCAGCTCGCGGCAGTCGGCCAGCAGCCTGTCCAAGTCCGTCATGGATCGACTATTG
TAATAGTGACACACACCACGTCTACACGTATTGGTGTATGGAAACCCCATGTTGAAGTGGCCGGTGGTCGTTACGCCCTTTGGCGGCACACTTGGTCTCG
AGCGGCCGGAGACCAATTCAGTTTGCGCCGGCCATGACGAGCGACCTCGAGCAGTTGCCGGACCATTTGCTACTGGCGCACGTCTGCCGCTTCGTGCACC
TGCAGGACCGATGGCACGGCCTGGCACGCGTGTCCAAGCGCTGGCGACGACTTACGCTTGCGTCCGTGCATCGAGAGCAGCACGTGGACTTGGTGCGTCT
CATTGGAGCCTTTTGAGGTGTGCAAAGGACTAACCGGTGCGTGTTTTGGACTGCAGACGTGGTGCACGGGAGAGCATGAGCTGGAGGCCGCGGCCGCCGT
ACTGCTCGACCGCCAGCCGCAACGCAGCAAAAGCGGCCGGAACTTGTCGGTCGAGGCATCGCAGCTGCAGAGTGTGGCGCTCTACGGCCCGCGGGTCACG
TCGCCGCTGCTATCGCACCTGGTCAAAGGCCTCGGCTGTGAGCAGCTCCGGCACGTGGACGTCGAGTCCAAGCAGATCTCGGACGCGGCGCTGAAGCAGC
TCTGTCGCTGCGTGGGGCTGCAGACGCTCGCGCTGCACTGTATCAAACTCACGGACGAGTCGCTGGTGGCCATCTCACGGTCTTGCCGCCAGCTGACCAA
GGTCGACCTCTCAGGCTGCTCGCGCGTGCGAGACGACGGCATCGTCGCCATCGCGGCCAACTGCCCCAAGCTGCAGAAGATCAACCTCACCATGTGCCGG
CGCATCTCTGACAGATCCGTCATAGCGCTGGCTCAGCATTCATCAGCGACGTTGGAGGAGGTCGTGCTTGATCGCTGCCTCAAGGTACGCACGTCTGCAG
CGTGAGATCGTTTCGCTCGCATTGTCTGATCGGCTGCTCTCCGCTAGGTTTCTGGGCCGGCACTCCGCTTCCTCATGAGAATGCAGCGCAACCTCCGGTC
CTTCTCCTTCGCGCGCTGTCCAAAGGTTCAGGGCGTTGACTTCTATAACCTCGAGCAAATAGCGCAAGCAAAAGCGACCATGCCGACCTGTAAGCTCGCC
GCATTGGACCTGAGCGGGTGCGCAGGACTGGACGACCGCGGTGTAGCGGCACTGATCACAATCAACCGGTACACGCTACGCTCGTTGAACCTCGGGGCGC
TGCAAACGCTCGGTAGCGCCGCTTTCGCAGCCATCGCGCGGTGTTCGGAGCTTCAGTCGCTCAACCTTTCGCTGTGTCGGACGCTGCAGAACGACAACCT
TGCTGCTATCACGGCCGGGTGCACACAGCTTTCAACTCTGCTTCTGCAGGGCTGTGTCGCTCTTGATGATGGTGGCCTCAAGGCGATGGCTCCTCGAGCG
ACGAATCTGCAGCGACTGTCGCTGGAATTCTGCTACAACATCACGGACGAGGGGCTCGCGGCCGTCGTCTCACGCTGCCAGCAACTGCTGCACCTAAACA
TCAAGGCTTGCAACCAGCTCACGATCGCCGCCTTCCAGACATTAGTTCGTCGAAAAGCGCTACTAGAAACGCTGAACATCGGCGCCTGCGCCGATATGGA
GACCACCGCCGCGTACTTCTCCATCGTCAAGCACAAGTTCCCTCGGTGTCGAATCCACTGGGTCTGAGCTGACGACCAGCGTCCTAGAGGCTCTGTGTAG
AGTAACAAATATGCATATTTACCTTATCCCTGGTGCAATGCGCGACTCTGATAAGACGAGATGGCCGTCGCTATAAGCGGCCAGCCCGTGAGGAGGTTCA
CCCCGGCATAAATTTAACGAATTTGTAGCGATGACTTGCTTGCCTTGCGTCTTTCATCTTTATTTATCTGGACGTGCATGGGCGTTTTGTCCTGCCACTT
GAGAAACGAGCGTGGGCCGAGCGCAAGAAAGCTCAAGCGTGAAGTCATCGTCCTCTGCTGTGGAAAACGATGTCGGGCCGCATTCCTAACGTCAGCACTC
GGATTGTGCCCAAGAGCATCACACTGCCCGAGACAGGAAGCTGCTTCGACACTACCACCGTGGTCCCGAAGGTAGGAGCTCAGTGGACATCGCCCGGAGA
CGATGTCGACACTGATGGTAGATTTATTCATGAACAGCGACGCTCGAACGAGAAAGTTGACGACTCGGCGCACATCAGCGCGTTCTCGCTGTCCAAACCG
ACCAAGCCGCACACCACCGACGGCTTCCTTCGAAAGGGCCAAGGCACAGGAGGCTCAATAGACTTGGAGAAAACACTCAAGGTCTGTGGGGATTGCTCGA
GCCAACAGTGGCGAGGAAATACGCTCACACCGTTTGATTCTAGGTTGACAAGTACGAGAATGTGTCTCCGCGCTCGCGGCACCAGCAGCCTGCAGCATTC
CGAGAGCGCGCTAACCCGCCCGATACGTCTTTCCGAAGGTGAAGCGATAGAAGGGATTTCATGGTTGCGCTTCAGAGTGCTCACGTTGTGGTGAAATTGC
AGATTTTATGAGCGTAGCGACCTGCCGATCCAGATTGACCACGGCGGCGTGCGCAACATGGTAGCCTGGAAAGTGGACATCACCAAGGTATGCGGTACAA
ACTCAGCGTCCTGGACTCGCGTTCTAACCGAATCTGTGGGTTTCTGTAGCTCGACTTCCACCACTACCTCCCGATTTTCTTTGACGGACTCCGAGAAGTG
GAGGAGCCGTATGCATTCCTATCGGAACAGGGCATCAAGGACATGCTCATCAACGCCAGCAACAAAGTGCTGCCTGTCATCCCGCAGCTTATTATCCCGA
TCAAGAGTGCGTATTTTCAGACAGTTCTCAAAATTCGGCTTGGCTGACGTTCTCGTTGTGCTAGACGCTCTCAACACGCGAAATGCTGGCATCCTGGTCA
AGACACTGCGCATTCTGCAGCTCATGGTGACGTGCGAGTCGGCTGCACAGCCAGGCACTGGCCCGGGACTAATCGGCCAGGCGCTTGTGCCATACTACCG
GCAGATTCTACCCGTCCTCAACATTTTTATTCGCAAGAATGGTACGCAAAACGATTTTCTGCGAGGTGTTGCTAGTGACTAAGCTTTGCACACGCTTCGG
TTTCTGCTACAGACAACATCGGTGACGCCATTGACTACGGTCAGCGCAAGCAGTTGAATCTCGGCGACCTTATCCAGCAAACACTCGAGATCATGGAGTC
TCACGGAGGAGATGACGCTTTCATCAACATCAAGTACCTCGTCCCCACCTACCAGAGCGTGTGCGTGGGCTAGCCTCGCAACGCCGAGCGTATCCCAGCT
AGCAAGACGAGAAAAGCGTACAAGGTAGATAGCGAGCAGCAGTCTTTGAAATTCGAGGCCCCAGCAAGAGTAAAGCAACCAAACTTTTTCTGGTCACTTG
TTATTCGTCATGTTTGCTTCTTCTTACTGCTTTGGCACACCGTTGTTTGTTACAGCAACATATTTCTTCTTGTACCGCCTACTGCTGCTGACTTGGGGCG
TGGTTTCACTCGAGGAGGAGGATCTCGGCGGCCAGTCAAGGACTGTGCATTGCTACTGCTTGTGCCTCGGCTAGTGACAGGCGCTGCCATCTTCGAGGGC
ATTGGTGCTCGTCCGTCGACTTCAGTCGGAACTTCATCAGTCTCGGGAACTTCTGCGGTCAAAGTGGACTTTGCTTCCGTCCGACTCGAGAAAGCACCCG
TGCAGTTCCACCGCCGCCCTTCACCCCAAGCTCCTCGTATCGCCTCAGTCTACGCTCCAGCTCCTTGTTCGCTTTCCGATACGCGTTCAGCTCCGTCACC
AGCGAAGAATTTTGATACGACAGCGCTGCAGCGAGTTTGTGTTTCTCTCGGTTACCAGCTTCCACTTGGCGCCGCAGCGAGTGCTTGTTCTGTAGCAAGA
AGCGGTTTTGACGATGCAGTTCAGCATTGACCTCGCCGGCTGAGTCTCCGCGAGCTTGCAGGGCGTCCAGTTGCCGCGTCAGGCGCTTATGAAGACAACC
GATCTCCGTGACGAGAGTGCTCTTCTCCTGCACGGCACTGCGTCGAACGAGCTCGCCCAGTTCTTCTTGTAGCACCACAATCGAGTGTCGGACTCGCTCC
AACCGCTTGAGGGCTGCCTCCAGGTCGCGCGCGTGCTTTCTTGCAAGCGAAGACGTCTCAACTCGCAGTCGATCGCTGATGTTTGCCTGCACCACAACCT
CTTGGTTGGCGTCATGCAGCTGGTTGAGGTGCTCTTGCATGTGTACCAGCTCGCGGTCCTTGGGGAGTATGTGCTTCTGCAGCAGCTCCAGCTGTGAGCG
GTGTACGCCATCCAGACGCTGCAAATTCTCCAACACGCGTCGCTGCTCAGCGAGTTGGGCTGCACCTTCCTCTTTCTCTCGCATGATTCTCTTCGTAAGA
GCTCTCTCGTCCGCCAGCTTGCCACGGAGAGCTTCCATCTCATGCAAGCGTTCGTCGTAGTCGCAGCACATTTGCTGCAGCTCGCTGTCCTTGTGGTTGA
GGTCTCCAAGCAGCATCTTGACCTCTTGCTTCAATGCTGCCGCCTTCCCATGCTGCTCGGCGAGCTGCGTTGCGCCCTTCTTCTTTTCGAGATCGATGGA
GCTAGCTAGCTGGCCCATTTGTACCAGTTGGTCCTGGTCTTGCTGGCTGAGCACTTCCTGCAGCTTCCTCCGAGTCGCCTCCAGCTCGTCGACCAACTTG
TTTTGTGAACTGTCAAACTGGACTTTGGCCTCTCGAAAGCTTCTTCCTGCCTTCGTACTCCAGCTGCGTTTCACGCTCTTGCGCTCGCTTCTGCTCGTCC
TCCAGGTCAAGCTGCGTAGCGTGAAGCTGTTCACGCAGCGTGTCACATTCAGCTTGCAGTTTTTCCAGAGTTACCAGGTAGTGATCTTGAGCCGAACGAG
CGTCTTCCGACAGCGAACGCAGCTTTGCTTCTCGGTCGTGGATAGCTCCGCCAAGACGAGCGTCGAGAGCCGTACATAGCGTTTTCTGTTCCTCTTCAGC
CGTCCGAGCGTGGGCTTCAAGCTGGCTTTGCAATGTACTTTGGAATCGTGTCCGCTGGTCACTCGCTTGCCGGCTCAGCATCTCGTTCTCCATCTTAAAC
TGCTGCAGCTCGCCATCCAGATCCAACAACTTGAGTCGAGCCAGCTCTACCTTGCTGCGGTCGTACACTGCTAACTCCTCTGGCTGGCAAATGCTCGTGA
AGGCATTAACGGACAAGTCGTGGAGGTGTTGGTCGTCTCGAATTGCTGTCGCTAAGGCTGAGGCGCTCTCGGCAGCTCCAGAATTCTCTCGACAAAGCTT
GCAGGCTAGGACAACGCCGTTCTGAGCGTTGGTGAGTAGCAATCGCGACCGAGCAGTGTAGAACAAACCTACTACCGGTGCCGTGTGCAGGTCTACACGC
CTAATCGCGTGTGTGAGCAGGATGGCCGACCGACTCCGAGCTCCTCGCTTCCAACTGAAGAGCACCACCGAACCACTCGCTGTGCCGACAAACAACAGGT
TCGAGTACATGTTGCCATCGTTGCCTCCCAGTCCTCGTCCTGCCTCGAGCGCCGTGATCTCAAACGCCAAATTCTCGCCCACACCGCCGCCAGTGGAACT
ATGAAGCGCGTCGGAGGTTAATTCGCCATTCACCCATGCACGCACAAGGCACTGGCTGCTGCTCGCTCGCTTGTGAGAGCCTGACACCCGCTTCTCGCTA
CAAACACTGCGTAGTCGTGACTTTCGTGGTCCATGTAGCTGGTAGTAAATGCCACGATGGCGTTGTCCGGCGCAAGTGTCTGCGCCACGCTGTGTGTCCC
CACAAGGTCTTCGACTTCGCCCCCGGCTTGCCAGCGTAGTTGGCAGTGGCGAAGTTCTCCGGCAGCATCGACGGCGAAGAAGCTGCTGTCATGAACAGAC
CAGCGGAACAGCTCGACGGTGTCGCAGAAGTCTCGAAAGACGCCAACGAGCTGCGGCTCTCGCTGGACCCGAGACAAACCTCGATACACGAACACTGCTT
TGTTAGTGGCGTGTACAGCTGCAAAGAACGCGCCGCTGGGACTGTATTGAGCCAGTGAGAGCTGCTTCTGCGGCATCTCGAAGGCCAAACGCAGCGAGTT
TTGCAGCACGAAGAAGACCTGAAGCTTGGACGCGAACGTCACCAACAATTCGGAGCCTGCGGGGTGAAGATCAAGGCTCAGCGGCGCTTGTTGCTCTAGA
AGGTGAACCACAAGGCACTCGTGGCAGTCGGTTTGGCTCCACACGTGGACGGCTGCGTCTCCGTCCGGGGACCGACAGGCTGCAGCGAAACACGGACGTC
TCGACGCTGAACTCAGTCGCTCCATTTGCTGGGATAACGGCGTGGACGCCAAGACACTCACGCAATTGTTTCATCGTCGCCGCGGAGAAGGCACAAATTG
CTGAGGTCGTAGGCCCCGTAGCCCTTTTCAGTACAACAAAGCAGCATGGCGGCGGCGGGTCTGTTGTCACGCTTACGATACGCTCGCTACGAGTACAAGA
AGCGGTCGAACGTCAGTACCCCGAGCGAAATCAACTCGTTAACCTGCACCCACGTACGTGTTTGGCACTCGCATGCGTCGCTGGAGATGCAGCTCCTTCT
CGTTCGCCTTGAGCATTTTGGATGCCACACGAACGACGGACACGAGTCCGTGAGTGCCTCCGACGACAACTCCCTCGCCGTTGTTCAAAGCGCTCATGCA
CAACAACCGCCCCAAGCCTTTGTGTACTGCACGGAGCGTCTGGATCAACTCGGCATTCACCACCAACTGCACGTCGCCGTCTTCCAGCAGACCAACCAGC
ACGTCGTCGGGCAGCCACGCGTGATCCGCGTAGCTCACGACGCTTTTGACTTTGGTCTCGTCGCCCGACTTGAAGCTCGCCAGCGGCTTGAGCGTGTACT
CGCACAGCGTCCAGAGTCGCAGCATATTGCCGCCGCTCGTAGACAACTGAGCCATATCGATGGGGTTGAAGCGGACTCGGGACACCCGGCAATGGACATC
GGTAAGAGCTACTTGCCTGCCACGACCCCAATCCCACACGCCCAAGCTCCAGCTCGCGTTCGCAGCCTGACCGCTGACCAATTTCCCATCAGGAGACAAA
GCTGTTCCTACGAACCGATCCGTCCAGGGCACGGTGAGAGTCTTGAGCAGGACAATGCGTCGACCTTTGCCTGCAGCTGGGTCAGGTTTGTCTGTTCTTG
TTGCAACGCTGTAGACAGCGATGGAGGCTGGCGAACTGGTACTCTCTGCATTGCCATCGTCGGCTTTCACTGCAGCGCGACAAACCGAAAGGTGCTGGCG
TTTCCCGCACAGCGCCATCGCTGTAATCTCTCCAAGGAACCCGACGATTGTCCTTGGTCCGTCACGAAGCTCAGGTCCTGTGTCTGCGTGTTCTGGAGCA
CGACGTACTTGCCGATGGCCAGCACAAGCTCCTGACGACTCAGAGGCAGAATGACGTCTCGGAAGGACGTGTCCAGCCCATTCCCATTCACCGGCACCAG
CGTCGGTGGAGATGGAGAC