Description :
From Genome Similarity Track
Location :
Scaffold_7:43823- 45337
Transcript NameFunction/comments
Physo_387681Hypothetical protein

Sequence
1514 bases(100 bases per row)
CTGCTGTCGCTCAGGCATTTAATCTACAAAGACTTTGGTTGGTATTATTCTTGCTTTGTGTGAGACTACATTGCGACCAGCAGGGATTCCCCGAGCTCAT
TTACTACTGGTGGTGTATTAATACAATTATGCACTACTTGATCCTGTTCTTGTCAAACAACTTCGAAGTACACCGTTACCGATGTTAGTTTAGAACATCC
TAATGCTACATGAATACGGTACGACCAGCTTAATACTTGATAAATGGCAATGGCATAATTGGACGAATTGAAGCAGACACGGGTTTTGTTGTTAGATATT
CAGGCGACCCGGACGAAATATGTGTGTGACTGCGCCATGTTGTATCAAACAGCTTTTTAATGCTTCTAAGTTACGTCGTCGCTGTACGCCCCGAATTCCT
GCGCGAGAGGAAGCCCGAGCGGACAGTATCAAAGCGAAGGGCAAATACCCGGTGTATCCTGCTCCTACAGGCGATCGAGATCTGCTAGACCTCAGTTTTG
ACGTATCAAATTTGAAACAAATTGCTGGCTTCATCCGTTTTCCCAGCAGGTTCAGTTGAGCAATTAGCCTGGCAGCGCTAAATCTTCAAATACACGGATT
TTCTTCTTTTGTCTCCTCCGGTAAGTTTCCGAGCAAGACACGGAAAAAGGTTCTGCCTAGGCATCAGCGCACATTTCAGTGGCAGGAAGGAAGGAAAGTA
CGTTGATTAGCTAGTTGTCGATGATCGTTCTGCTAAGTACAAAAGAACTAAAATTAAAACTAAATCCGTGAAATATTGATCCGACGAGCAGGAGAAGCCC
GAAGCGTTGAAGTACCAACTCAACTAAACTCTGCGTTTTTCAATCCATCGGAGTGACGATATATACTGTAGACTGTCAATGCCTTTGAAAAGAAGCGGTC
AAACTTGGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNN