Description :
From Genome Similarity Track
Location :
Scaffold_274:4382- 7854
Sequence
3472 bases(100 bases per row)
GGTCGCCCGGTACGTTAAGGCATGCGAAACATGTCAGCGGGTCAAACCCGCAGGGCACTCTTCGGCTCCACTACAGAGCCTGCCCGTACCGGCTGACTGT
TGGAAGTCGATGTGTCTTGACTGCATCTTTGGGCTTCCCGCCGGCGGACACGGCAACACCGGAATTTTGGTGTTCGTGTGTCGGCTGAGCAAGAAGGTAC
ATCTTGCTCCGATTCCCGTCACTGTTACGGGCGAACAAACCTTGCGGTTTGTTCGTCGATGGCGTGTTCCGCTATCACGGTCTCCGGGAGACGATTGTCT
CGGACCGAGACCCGCGGTTCACTGCTGCGTTTTGGAAAACGCTGTTTCCTTTACTGGGAGCTCGTCTGCAGATGTCCACAGCGGACCATCCGCAGACAGA
CGGTCAGACATAGCGCGTCAATCGAGTGCTCGAGGACACTCTACGCAGCGTGTGCGCGGCAGCACCACGTACGTGGTCGACGCAGCTTCCAGTTGTTGAG
TTTGCGCTTAGCAACGCGGTGCACGCGTCCACGGGGTTCACGCCGTTCTACTTGAACGGCTTCCGTCACCCCAGAGTGCCTCTCACTCTTCGAGGAGACA
CTGACTCCTCTATTCTAAGTGGGGGAGAGGCTCGGAAAGCCCTTTCCTCCCAGGTCTCGGATGTGAGACCAGTTTCGCTGCGGAAACAAGTGGAATCCTT
TATGAATACCAAGCTGAGCGTTGTCAGCAGGGTCCGCGATGCCATGGCAGCGGCCCAAGATAAACAAAAGGAGTACTCAGACAAACATGGAAGAGGAAAC
TTAAGTATATTTAAGGTGGGGGACTTAGTGTTGCTAGATACGAGGAACCTACATCTTGACACTGTCAGCTCTGTCGGCAGCAACAAGCTGAAGCACCGCT
TCATCGGACCATTTGCAGTCCTGGCCAGACATGGTGCGTCGTACACCATCGACCTGCCAAAGTCAATGACGACGCACCCGACGTTTTACGTTGGACGTCT
TAAGCGGTACTTTGATCCGCAGGGGGTTGCTGACTCGCATATTCACCTTGCCCCAGCTCCTCGAAGCGAGGGCCGGTCACAGACGTCGACGAGGGCGTCG
GAGCAGGCACCCAAGCCTCGGTCGGAACGGCAAGGATGCGGTCAAGACCGTACGCCGGAGGGGCTTCATACGAACGGACCCCGGCGCCATACGCCGAGTA
CGCTGAGTACGCCGGGTACGCACCATACGCGTACGTCTGGGAGTGTGCCGCAGGCGGCTCCGGACGTGGCAACAAAGCCTCGATCCGCTGGATCATGCGA
AAGGCCTCGTCCAGATCGGACGAAGAGGCCCGGCGATCCACCCGCAGGTGCAGGCTCGCGACCTCTCGCTCCAACAGGTCCAGGCGGCCCGCAAGACGAG
CGAGCCCGCCCTGATTCCCGGCCTGGGCGGCAGCATCACCGCCAGTCTCAAGGCCAAGTGCAATCTCAAGCACGAGGACACGTTGACGGAGGCGGTCAAC
CTCAGGGCCCTGTGTCGGACCCGCCGTCGGAGCACTCGGACGAGAGGGGCTTTCGGGAGGCGCCGAGTACTCGTACTCGTACGAGGGCACCCCTGCTTGA
CCGGAATGGAGAAGTCCACTTCCACGTGGAACGGATCCTCCAGGAGCAACGGCGGCGCGGTAAGCGACAGCTCCTCGTGAAGTGAAGGGGTTATGCCCAC
TCCGAGAACTCGTGGGAGCCGATTGAACGGCTCCTGATTGACTGCCCGAAGGCTGCCGCAATCTGGGAACAGAAGCGGCGGCAGCTTCATAAGTTCCGTG
GGTGAATACTTGAGAGACTCCACCCAAGCCCAGAACATGTCCTCACAAGAATCCCACGTGGGACAGTTCTCGGGCATAACCCAGGGGTATCCCCAAAGAG
GATAGAGACCGCCCCGGGTCTCGGGCTTCTTACGACAAGTCGTGGAGTCCGTAAGAGGGATGCGGTGTGGCGCGAGAAGCACATACCGAGCCGCCTCCGA
ATTGTCAACAAACAACAGTTCCTTCTGAACAAGGGTACGCTAGTAAGCACCCCTAGAGGTGTGGCCGCCAACAAGGCCACCAGGAGCGACGAGAAACTCC
AGGAAGAGGTCAGCCCCAGAGCTCTCCTCGGGAGGCCAGTACCCTCTTGAGTTGATGGCAGCTCCCTGGCTGACGGGTGCCACCACCGACCCCCCCCCAC
GCCAACGCTGGGCAGCTTGGAAGTCCTCCTGCTGCTGGTCGAGGCCATTCGTGATCTCCCGGGGCTCCGAAATAGCACCCTCCTCCTCTTCCTCCTCCTT
CTCATCCTCTTCATTAGAGGAGTCGAAGAGGCCCCGATGAGAGTACCGAGTCTCCTTCTCCTCGCGGAGTGGAGACTTAGAAGCCGTACGCTTCTTAGAG
GGCTTGACGCCTTCGGCTTTAGCGGCCTTAGCACGCGCAAGAACATCGGCAAGCGAGAGGCGTTTGCGAGACTTCTCTTCCTCATCGCCACCAGCTTTGG
GAGTGCCCTAAGCCTTGGTGGCCGGACTCTCAGAGCGCACAGACGTCCTGGGGCTGTGATCACCTTGATCACTAGCGAGCGACTGCACGCTGTCGTCCTT
GTGCTCACTGGGCACTGGGCTGTGCCCTCCCACAGAGCCCGCAGGAGCATCGTGCGTGCTTTCGGACTCGGCTTCGTCCTCACTGCCAGAGTTGAACTCA
CGTTCCACGAACCGAGGGTTCCTACGATTGTCTGAGGCCGAGGGCGACGGACTGCGGCGCTTGCTTGCTCGCTTGTCCACAGCCGCGTCACCCGAGGAAC
CGATCGCCTCGGAGGCCACCTGAGTAGCCTCCTTGAGTGCCGAGCCTTTGCCGTGAGGCTTAGTGCTCTTGGCTTGCGCCTTACCGGCAGCAGCCTTGGA
GCGTGTCTTAGCACCGCTCTTAGCAGTTCCACGAGGCATGATTTACGGTCGAAGTGGAAACCCAGAAGAAGAGCGCACAGACTGCTGCTCGAGGCTCTAA
CTGTGAAGTGAGCCTCCACCGCGCTCGCGCGGCCAAGTCGATGGTTTTCGACTTTGATAATGAGAGGTTGTGACGAACACCTCTTCATTCTGATTGGTCG
GTAAACCGAACCTTAGTGGGGGAGGATGTAACGGTGTACGTAGCCCTAAGTGTACCCTGGTTACATGAAGTGTGACACTTCACACTTTAGGTGTATGACA
CGTCATACTCCGGGATATTTGGTACAAGGTACCAAGGTCGCTCAAAGCCAACCATTGGTCAACGACATTGCATTTCTATAGGTGACTTATAGTTTCTATT
AAACCCAAACTTTATCTACCTTTAAATATACTCAGTTTACAATCTACCTTATTTAGGTCACTTCGCTCTCTTTTGAATAAAGAGGGGGCCTGTGAACTGC
CGTTCACTGAGAGTTTGTATACTCTCGGAAGATAACTTCCTCTAGCGCAAGGTGCCGTGTGACCCCGTCACA