Description :
From Genome Similarity Track
Location :
Scaffold_85:43806- 48818
Transcript NameFunction/comments
Phymu_g3843hypothetical protein PHYSODRAFT_397963
Phymu_g3844hypothetical protein

Sequence
5012 bases(100 bases per row)
ACTCACAGGAATTCTAACTTCGTTAACTGCGCAAGTGACGATGGAATGGCCCCCACAAAGTTGTTACGGTCGAGACGTAGCGTGCGCAGCGCACTGAGTC
GTGACAGTGTATCGGGCACGTAACCACTCAAGAAATTGGAGCTTAGGTCCCTGCGAGCAAAGTACCACGTCGATGAGTTCTCAGCAATAAAAAACAATCT
CCCTACTCATTATTCCTTGATGAACTCACAACTCTCGTAACCCGCTGAGATCTTTACGAGGGAAATCCGATGGCAAGACCCCCACGAGGTTGTTGTTTGG
CAGAcggctgctccagcatcaagaCATGAGCTCCCCAATTGGGTAATGTACCATCCAGTCTCAATTACACTTACATAGACCGAATCCGGCCATTGCGGTC
GCACACGATGCCGTACCACTAGAGTGTATCGAGTCAGTAATAACACGAAGAGTTGAGCTTGAACTGCAGTACTCACACTGTCGAGACACGGGTCGCTGTG
CTCGTTCTGAATGGCCCATTGCCCCACCCAGCGCTGGCCCTGAGTGGCCCAATACAGCAGCTTTAGCGCGCCACGCTCGTTCCGCGTGATAGCCACAACT
GAATTCATGAACGACAGCGtcagcaagagcaagagcaaggcAGCGGCTATTACGTTCCGGTGCATCGTGAAAAAGTGAACTGTATTAGCTTCAACATAAC
TAAcaacatggctacaaaaATAATTTCGCACTTAGTCAAAATACTCCAATACCACATATATATCATTTCAGAGGTCGAGGCACTATCCGCaccgacgagg
agcagcgccaccgagatgctgctggagaagccCGAGGACGTCAAGCACGAGAATTCTACGGGAACAGGTAGGTGCTGAACTTGTAACTAAGACATTTTTC
TTGATTATCCCGCTCTTGCGGTCTCTATATTCGCTCTGGTTGCTGCGTTCTGACGCGATGAAATCGGACGATACATGTATGATATTATGGTAGTATGCGC
TATCTACGGCGTGGACGCCCACCCtacgctgcagctgttcGCCACCGCTGGAGGAGACAACACAGTCAAGATATGGTCTCTGCAGGTACCACAAGAGGGG
GGAATTGCCacgtttgagctgctggccacacTGGCGAACCACCAACAGGCCGTCAATTGCGTCCGCTGGGCTGGACACGGTCGCTATTTGGCCTCAGGCT
CTGACGACCAGTTGGTACAGCTatacgagctgcaggaaggtactcctgctcctgttccttTCGGCTCCAATGCTCGTCCGAATAAACAGAACTGGGTGCG
CTGCTCCACGCTCGAGAGACACACAATGGGTAAGAAGACAAGGCTTTCTCTCACTATTTGTTGTTTTGAGTATGTAAAGGTGCTGATACTGGTGACTATG
GTGCAATTTAGATGTGGCAGACGTTGCGTGGTCACCGGACGACCGCATGCTGGCAACCTGCAGCATTGACAACACCATTTTGATCTGGGACATTGGCGTC
GGTGCACTGAGTGAGGTGATGACGCAGCCGCTGCAGACACTGACAGGTCACAATGGCTGGGTAAAGGGCGTCGCATGGGACCCTGTCGGAAAGGTGTGGG
AATGAGTGGCCTAATGAGGATGTTGTTGCGGATCTGACGCCTGCTCGATTGATTTGCGGTGTAGTATCTATCGAGTGCTGGGGAGGACAAGACTGTGCGG
ATGTGGAAGGTTGCTGACTGGCAGGAATCTGACGTGGTGACGGAGCCATTTGAAGGATGCGCCTCTACGTCGCACTTCCGTCGGCTCTCGTGGTCTCCTG
ATGGTTCAGTGCTATGCGCTACCCACGCTTTCagttcgaagaagaacatcgcGGCTTTGCTTAATCGTGGAGCGTGGACCAATGATCTTAAATTTGTGGG
CCACCAAGGCGTTGTGACCAGTGCGCGGTTTAACCCCAAATTGCTTGGTGTGTCGCGTAGTGGCATGGGCTGGTACTAGCTTATCGTACTAATACTTGTG
TGTTATGTACTGTAGTGACAAAGGCGGAACCGGATAAGGAGTTTGCATGCTGTGCCGTGGGCGGTGAAGACGCGACTGTAAGCATCTGGCTGGCACATCT
AGCACGTCCATTGGCAGTTATCAAGGATTGCTTTGACTCGTCGGTCACAGACCTGACATGGTCCAGTTCCCAGTCTCTTCTCCTTGCTTGCTCGCTCGAT
GGATCTATCTGTTGCTTTCAGTTTGCAGGAGACGAGATTGGGACCCCCATCTCCGATGCGCAACAAAGCAAGCTTCTCCAGGCAAAGGTGTGCAGGTAGC
TTCCCTTGAACACCACGTGGTACATATTGACGTTACTTTGTTACTTCTTTGCTTTGCATAAAGTATGGATCCCGAGCTGGCATCACACTCGCATCAACTC
TGGTGGAGAACCCCATTCAACTTCAGGTACACTCAATTCGCGCCAGTTGGTATGGGACGAGGTAGTTGACGAACGAGATTTGTTTTGTAGCTTGAAGAAA
AGTCGACGACCTCACCACGTTTGGCGGTTAATCGGAATTCTGGACCCAGTGCTGCGCCAGCCGTGACACACACAACAAATACACTCGttccgaagaagaa
gaaaaagatTGGTGCACAAACACCCGGTGCACTGCCGACCAAGCCGCCAAGCGGAGCAAGCCAGAGCGACAAAAAGCGGATTTCCCCAGTTCTACTTCCA
ACCGACGCGAAGTCTTCAGCCAACAACAAtccagcttcatcgcgaAACAATATTTGCAATATCCTGGGCCCCACTGTCGTGTCACCAACCGCTTCGGATG
TTACACTCTTAGATGCTCGAATGGCTTCAGGAAGTGGGAAGGAGGTTAGCGTTGTTCCGGACGCTACTAATTCTGCTACGATCCAATCAAAGCCCACACC
AAACCTGAGCGAGaagactggagctgcccCTAAGGAGAAACCGTCTCCGGCGACGACAAACGGCACGCCATCTAGACCATTAAAGCCGGAAGTGAAGAAA
AATGGAGTTGATGGAGGTTCCTTGAAGAGAAAACGAGAAACTGAACGTGCTCCAGCCCAAACTGCTACAGTGATTGCAAAGTCGAGGGAAGTTGCGGCCC
GACCACCGAAGCTTCTGAATGAAAGGTTTGCTACATGCCGTTTAAACTCCGCATGCGGAAAAGCTACTAACTTCTGTCGTGCAGTAGTGCTGGCGTGGCC
AGCGGAGGTCAGTTGCTGCCTGAATTTCCACTTAGACTGCACTTCTCTGTAGAAATCGATACGAGCGCACAATCCACCACTGTCAATgtcagctccagtg
gcaGGAAAGGAAGTGGATCGATGTCTTCTAAAGCGGTGGTGGAAATTACTGTTCACAACCTGAAGAATCCTCAGCCAGAAGAAATCATAGGTGAGTTACA
GCTACTGATTGCTACGGGTCTTTTTGTTCAAGAAATACTGACACTCTTGAGCACACTACTTAACAGAGTTAGGCCCGATTTATTCAACCGTTAAATGTTC
CGAGGGAAGCGAGGTCAAGTGGATTGACCGTATTCCTGGTCGAGCCATGTGCGCAGTGGGAAACGCGAGATATTGTGCTATTGGTGTACACAACGGCGAT
CTTCTTATTCTTAACACCAGCGGAAGACGTATTTTTCCGTGCATTGGTACGTATACGGCAGCTTCACTCGTGTCTGTTCAGAAACTGACGCTCTCCGCGT
TGCTGTTCCCAGCTCTGGGCAGTGCTATCTCAGTGATGGAATGCAGTGTGGGCGAGTCGCCCTATTTACTGGTGATCCTGGTCACAGGTGATCTCAGAAT
CTGGGATCTAGCACAGCGCAAGCTTACGCTCTCGAGCTCAATAGAGGCGATTACAAATGTAAGTTTGAACTTCATAAGCATAGACTTGATTTCTGACTTC
TTGTACGATGTCGTAGATCACGCCAGAAGACCACCGGAAGCTGACACTTCTCCGGTGCCAGGTGACAACCAAGGGGATGCCACTGATTACGTTTGCAGAG
TCAAACGCAGAAACGAAAGCGAACTCGAGCCTTCTCTCGTACACATTTGACTCGGGGATGTCAGCGTGGTACGACGGACCTGCGACTTTTTACTCTTTCT
TGCTGTATTATTCATGTTTCTGGTGTAATATCGTGTAGGATGCGAGTGGCTGACGACAGCTTCGTGTTCTCGGACTTCGCGTCTGCTCTGCCGACAGACG
CAGTTCGAGTCAAAAGTGTTCCTGTACGGATTTTGTCGTACAATTTGCACCTGCTGACCAGGTAAATAACTGACCGATGTCCATTTTGTATTGCAGATCG
GACCACTGCGACGACTCCAAAACGCTTCTGGGTACGGCCGAACCCAGAGAGGAATCGCTTCGGCAATGCTGTCGAGTATGTCAGACCCGCTGATGCAGCG
TAACGTGACGCGCTCGCACCTCGAGCACCAGGTCGCTGCTGCGGTTATCCTAAAAAGCTCTGCTGAATATCGCTATTGGTACGTTTAAGCTCTGCAATCG
TGTGCACAATGGTGGTACTGATAAGTTTGGAATTGCGTACTTGACCGCAGGATTCAAGCGTACGCGAGGTTCTTGACGCATGACGAGGATGTGACTCGTC
TGGACGAGTTGTGTGCTGAAATGATGGGGCCCTTCCACGCGTGCGTGcttcgtggcgctggaggtgTTATTGATATGAGTGATACTATACTAAATGCTGC
GTTCTGTTCTACAGGCCGTCATCTCCAGTCTCTTCAGAAAAGAAAAACGCTATTGCGGATGAAGGCGGCGAGTGGAATCCGATGGTGCTGGTACGTTGGC
TGTCGTTTCGTTAGCAATGGCCAAGCCGCCTCTGTCTGTGCCTCTATGGTCTAACATTAGATGGGAACAGGACCTCTTTAAACGAGACGTGTTGAAGGCT
CACATCCTGCCGACGATCGCAGCGAATCGCGCGTTGCAGCGTGTGGTGGCCAAGTATCAGCTGATGATGAGCGAAATAGAAGCACGGgagaacgacgaag
aagacgaatCTT