Description :
From Genome Similarity Track
Location :
Scaffold_1635:438- 2512
Transcript NameFunction/comments
Phypl_g13860hypothetical protein
Phypl_g13861hypothetical protein

Sequence
2074 bases(100 bases per row)
GGCGACACACCTGGCCAATGATGTATGCAGCTCCAATTGACCGGTAGGCTTTAGCTTTCATCCATGCCTCCTGGTCGGGTGTAAATGCCACTAGCTTGTC
GACAAACACGTCTTGCAGCATGATCGGCGTACGGGATGGTGTTACTGATACCGCCGAAGGAGGAGTCTGCGGCGTAGAGCTTCCGATAGCAGTGCCAACA
TGCTCTGGGGAATAAGGAACGGCTGCTAGCGCTGTGCTTTCGTCAGCATCAGCTGTGCGCTCGCCTCGCAAATCCCGCCCACCATGCCAaccacgtccac
ctcgcAATCCACGTCCACCATGCAAATCACGTCCACCTCGCAAtccacgtccaccttgcAATCCACCCGATCCACCTCGCGACCCACGTCCATCTCGTGA
TCCACGTCCACCTCCGGTCCCACTTTCACCACGCGATTCACACccgccacgtccaccagcgccagcgcgagtCTCGTGGCCGTCGGCGGCACCCCCCATG
CTTCCACGTGCTGCAAGACCAcgtcagcaacaacaacaacaacagcaacaagaacaacGTCAGTCCATGCACGTCAAGCCGTCCAGGAGCCACACGGCCG
TCGTTGCACCAGAAATCCCACCGCtacgagcggcagcaccgactTGATCGCCGCGTCCGCTTTCACCATGTCCTCCGCGCCCACAACCGCCTGCGACTTC
GGTTGTCTCGTGGATAGCGGTTCCTGCAAAGTTgtcaccaacaacaacacagTAATATATCAGTCTCCGCCCCCTCCCCCAATCAACAATCCACATCACT
ATACCTTCCGTGTGCGCGGTGTTTCCTGGCGCGAGAGCGGCGATTCCTGGCTGGTGAGCGGTTACAATATTCTCCTGGAGACTTCTGCTTTCTGCATCGA
CATGGCGCAGAACGGCTAGTTCTCCGACTAGGAAGTCGACACCTTCCTCCCCCCGTAGATTTCCCCCTGGTCGAATGTAAATGTAGCGTGAGTCTAAGCT
CCGAGTTGGCGGCCGCTTTGACGTCCAGCTGCCTTCCGTAGACTTGCCTACACTTGTTTGAACAATACAGCCCCTCCGAAGCTGCTAGCTGTGCTTACAG
ATACATCGGCATCGCTGGCCGATCTGGTGAGGCGACGGTGCTTCCTTGTGTCCGTCGTAACCATATCAAGCTCACGCATCCGCTTGCCACCAGGCTCCGG
TTCGGCCATCCCCTTTTCGGTTGTGACGGACGGCTGCCACACGTCGGCCCACTGACTGTATTTTGCGAGGTAGTTTTCCTATGCCAGTAACTCATTCTCC
AAAACATAATAATATTTGAACTCGTAGGATATTTAATGAAAAGGTGATTTGAGGGTGCGACATTTTAGCGGCAAAACCCAATACAGTATCTGTCACACAA
ATTATCAACCATACAAATTACTAGATACATGCATATTTCGACACGAAGTAAATAGTGCGTCGAAGCCTGGATCGTTGGGGGGGGGNTCGACCCCACCAAG
GTCGTGCGCACGGGTCTGGTGGACGCCTCGAGCGTGGCGTCACTCATGAAACTGCACTTCAGCGACCTGCGCTACGTTGAAGAGCCTAAACTAAAGCCTG
TCAGCAGCAATGCGACTACATGAGCATCTAGACGACAACCCTGGTGCAACCTGCAGGCGTTCATTCCTTTAGACAATGGCGCGAATGCGGCGAGCATCAT
CCTGGTGCCAACCCCGGTGCATCATCATCCAGAAAAGAGGCGGCAGCTTGCAATTTACTTTTATTTTCCTCGTAGTTTACATTCATGGTACGTAGTACCG
TTTAGTTTTGTCAAATTAGTGGCATACGCTTCAATACAGAAGCACTTTTATCAATATTAGCCAATCAAAACGCGCAGAATGTGCCCTTTAACCGAATCGG
CTACCACTGCCAAATGCATCTTGTGTGATTTGGCACCTAGTCCTGTCTATTACAGCTACTAAAAGGGCGGaaaatgcgcccttttagtTTCAATTGACTT
AAACTTGTATACTATACTTTATCCCTGcggctcgcgaaagggttaaggTAGACATCCTGACAGCAATGAAGCGG