Description :
From Genome Similarity Track
Location :
Scaffold_1323:438- 2242
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_1323-snap-gene-0.3Vertebrate symplekin (SYMPK)

Sequence
1804 bases(100 bases per row)
TGGACGAGGTCAGCGACTGGATCTCAAAGAACGCGTCGTCCGTGGCCGAGCCGCTCATCTCGGTCACTGAGGACAACGTGGTGCAGGTGTTTCTCAAGCC
CGTTGACGGCGTTTGGTGCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NGGCGACGAGAAGCTGCGCGAAAGCGTGCTATGCAGACTTGCGTCGAGTCCGTGGCTGCTGCTCACAGACGAGCGCAACCAGCCGATTGTGTCGGAGGAT
CCNNNNNNNNNNCCAGCCGGACCAGTCAATGATCGCTCTTCCGGCCGTGTACGAGACGATCTTGGCGTTCGTGCTCGAAGATTACGCCGTGCGCTCGACG
CTTGCAACTGCACTGCTCTACCACGAATACACGCGCTTTACGACGTGCCAGGTGAGGAGTACTACGGGACAAAGTTCAATNNNNNNNNNNNNNNNNNNNN
GGTGGTGGTGCCTACAGACGCGCTGTACCGCAAGGCCGTGGCGTATTTCCTTGGCGCGCTGCGCCAGAAGATGGATCTGTCGTCGGCGAGCGACAAGAAG
CTCTTTGGCGCACTGGTGCTACAGCTGCCGCGCATCACGACCGAGGTGCTCGTGGTGCTCGCCAAGCTCTTTGACGAGCCGAATGGCGTCGTGCTTGGTA
TCACCGTGTTGCGTGATCTAATCAAGGAGCGCACCGTGAGCCAGACACCCGCGCTGCGCATGCTGCTCCGGTACACGTGCCACGACGACGAAAAGTGCCG
CAACTCGTCCATTCGCTGTGTTGCGAACCAGTTGTACGCACTGGAGCCGCTGAAGGAGCCGATCGAGAAGTTTGCGATCCATTTGGTGCATTCGCTGCAA
ACAGCCACAGTCCATGATGACCAAGATGAGGAATCGAAAGCGACAGATACAGTAACAGAAGATGACGTCGAGATGGAGGCATCTGCTACTGTTGCTACAG
AAGCAGAAGAGAAAGCGCCGGTTGACACGAAAGCATTGGTGAAGCAGCCTGCATGGCTTGACGCGCAGCTTCGTGCGATGCAGACCTCTGAGCAAGCGCT
CGCGACCGAATTGCTCGCCTTTGCGGCGCAGCATGAGCAGGACATGCAGCTCTCGAAGCCCGTGGACAACGACGAATCGGAGACGCTGCGACGCATCGAA
TTGTATCTAGCGCTGTGTGCGAAGAAGCCGACGCTGCTGGTGCACGTCATCGCGGCGTACGCGCACGCGTCCGAGTCGGTGCGTCAGGTGATTTTCCACG
CGATCGAGAAGCTCATCAAGCATCTGAAGCAGCGCGGCGGTACGTCGAACGTCGTGGCGCAGCTGCATGGCTTCGAGGCGAATGNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTGCGTACGCGCAGCAGCAGCAGCAGTGAAGATGCAGCGGTAACGGAGGAGTTGGTG
CAGCAGGTGCTCGGTCTGTACCATGCGCACGCGCAGATTCCCGACAGCATCTCGGTGCTGATCCCGATCCTACCGAGCATCCGCGCCGAGACTTTGTTCC
CGCTGCTTCCGCCACTGCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGGTCGTGGCGCCTATTGATCTGCTCGTGGC
ACTGCACCACGTGGACCTCAGGAGTGAGCCGGCGATGCAGAAGAAGGTGATCCAGGCTATCAACCTGTGCGTCGAGCACCGCCACGCGTTCCCNNNNNNN
NNNN