Description :
From Genome Similarity Track
Location :
Scaffold_462:4379- 5869
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_462-snap-gene-0.12Amino Acid/Auxin Permease (AAAP) Family

Sequence
1490 bases(100 bases per row)
TCGCTCTCGTCTTCGCTCTCGCCTCCAGCTCCGACGACCATGGGCGGCAAGGCATTCCTGACCATGGAGGATTTCAAGATCGCCTTCAACCTCTTCTGCT
GCGTCTACGGCGTGGGGACGCTCGGCATGCCGGGCAACTTCTCGCGCGCCGGACCGGCGATCGCGATCGTAGCGCTCGTCTTCATGGCGTTCGCCAACGT
CTACTCGTCCGTGTGCATCTCCAAGGTCATGCTGCTGGCGCCACGGACTGTGCGAACCTACGGCGACCTGGGCGAGTGGTGCATGGGGAAGGCTGGCCGC
TACCTCGTCGTGGTCTCGCAGATGGGGGTCTGTCTGCTCGTGCCCTGCGTTTTCCTCGTGCTCGGCGGCTCGCTGCTCGACGGACTCTATCCTGACGCGT
TCGACCAGAAGATCTGGATCGTGTTCATGGCGCTCACAGTGCTGCCAGTGTGTCTGACGCCGACGCTCAAGGAAGGTGCTGGAGCGGCCTTCGCCGGCTG
CATGGGAACCATCATCGCCGACTGCATCGGTGTGGCCGTCGTCATCCATGGCATGCGCGGCCACCCGAGCGNNNNNNNNNNGTTCAAGCAGGTGGCCGGC
GCGTTCGGCAACCTGTCGCTCGCCTACGGCGCCGGCATCGTCATCCCGGCGCTCCAGCGCCAGCACAGCGAGCCGACGCGCATGCCGCGGGTCGTGTTCG
TGACCATGATGTTCGTCTCGGTGCTCTTCCTCACGCTCGCGTCCACGGGCTACTCGGCCGTCGGATGCCAGATCAGTGGCAACCTGCTCTTCACCATCTA
CCCAGACCCGACCACGGGACTCACGGACCTCGGCTTCCACTCGAGCTGGGGAGCCGTCGTGCTCGCCTACCTCTTCATGCAGCTGCACGTGACGGTCGCC
TTCGCGGTGATCGCCGCCCCAGCCTTCTACATCGCCGAGCGCATGGTGCTTGGCATGCACCAGAAGCAGCCCGAGGACGTCGAGGCCGGCGGCGTCTCCC
ANNNNNNNNNNATACGACATGTCGGCCACACCTGTGCTCAAGAGCCGGCGCAGCTCCAAGCACTCGGTGGTGTCCATGGCCGACATTGACCACGAGGACG
ACGAGGAGGTCGAGGCTGCCGAGTACAAGGGAGCCAACGCTATCAGGTATGTCCTGCTGCGCACGGCCATCGTGGCGCTGCAGGCGCTAGCGTCCGTGCT
GCTCAAGGATCACTTCTCGGACCTGAGCGACTTTGTCGGGTCGTCCGCCATCACCATGAGCTGCATCATTTTGCCGATCGTCTTCTACCTCAAGAAGTGC
TGGACCAAGATCTCCATGTTTGAAAAGGCTCCCGCGCTTGTCGTCGTCGTCGTCTGCTTCGTGCTCGGCTGCTACGTGACATTCACGTCCGGCAAGGAGC
TGTTCGCGCCTAGCGAGAGCGGCGTCGAGTACCCGTTCTGTCCCGAGGAGTTCCAGAACGAGGTCTACTACAACTACACTGCCGAGCACG