Description :
From Genome Similarity Track
Location :
Scaffold_219:43789- 47269
Sequence
3480 bases(100 bases per row)
ACAAAGTGGTACTGGTATGCAACTGGTGTGGGTTTTGTAATGTTTGCATTCGGTTGGTGCTGGATTTGCGATTTACTCATCACAGGCGCCTCTAACCTTA
CCTGATGACAAACCATCTGCCTGCTTGCGTACAGCGGTACAAAGTTGAAGTGCGTTTGTGCTTCACGTCGCGCGCGGGCTCCAGGACAGGCGGCACCCTC
ACAGAGGATCAGTCTTTAAAGACTCAGGCGTAGATTGACTACTAGTGCTACCAGGTGTAGCGGAGCTACACAGCACTTAAGTCAGAGGAAGACTTAGTGC
TCAAAGAGAGATATTATTTCCAAAGAACTAGACTCTATGAGTCAACAAGCGTAAAGCTTAAGGTCTCTGTTCCCGGGGACCGAACGATTCAGTGAATCTA
CAGCACTTAGTGCTCAAGAGTAGCTACCTCAGGGAGGTGTTGCTAACTCTTAACGACCAACGATCAGAGGCGCCTCGCAAGGCACGTGTCTTAGACAAGA
TCAAAAGGGGAACTGAACTTTATTTACGTTTAACTCTATAGAATATCTTAATCCTAATATTACCTAATCTAGGCACTCATGTCCTGAATTAATATCTTTT
AAGATCTTTCCTATCTCGTGGCTGACACCCGTCAGCACCTATAAACCGATAAGATATTCTATATATCTTTCAGTGGGATACCATCCCGTGTGTCTAAGAC
ACAGGGTACCGAGTACCCTACGATGTGTAACCCCTTTATACCCTCCCATGCCAGACTGCCGTTTACCCAAACGTCAATCGAATTTTGTTCTTCGACGAGT
TCCGTGCGCTTGCGGTTAACCTCACGGTAACGCGAAGCTTTAGCACCATGTCCTCATCGTCTAACTAGTCAAAGGCGCTTCGTGCATACCTCGGGATGGA
AGAGGCAGTGGACTATGGTAGCGATACCAGTGTCCCAGGTGATGCAAGGAAAATGTCCGATACACCCATGCCTGAGGTACGACCTCTTACTACGTTAAGT
CCGTTTGCTGAACGTGATGATACAAATGCGCCATTGGAGCCGCATTCAACACCCGGTTCGGATGATGCAATCATCACCAACCCTCTCGATGAGCAGCAAC
AGTTGACTGTTCAACGAGAAGAAAGCGCTCGACGCCATGCACAAATAGTTACGACCCTTGCGAACCAGCGTGACTATGTGTTCACTCCACTCAGTGTGGA
GGAACGTCTACGTCAAACGACTGGCCAAACGTTGGCAACGTGGACCATTAGTCCTGTAGCTGCTTCTCCCGAGGAAGTGGCAAGTTGCCAGGCACTTCTT
GAGAGGTATTTGGAGCCATATCTGGTTTGTACTCGAAAGAGAAGCTGTACTCCTCGAAAAAGGACAGCCACCTCGCCATTCTTTGCGAGAGTTGTGGACT
GTTTACGGCCGTGCGTAGTGATGCATGGTCCGTATAGACGATGAACGGTCTATCTCCTAAGAGATAGACACGAAACTTGGCCAGTGCATATTTCATGGCA
AGGAGTTCCTTGTCATGCACTGGATAATTACGCTTAGCTGCTTGCAGCTGACGCGATTGATAGCACATGACGCGCTCTGCGCCATCTGTATCAAATTGCA
TCAACGCACAGCCGATCGCAAAATCCCTGGCGTTACAGACCACGTGGAATGGTCTGTCCTGATCTGCAATCGCCAGTATGGGCGATTGCACCAAGATCTG
TTTGATACGTTCAAAGGAACGCTGACAGTCAGCGTTTTCACGACCACTTCACACTTTTCTTGAGTAAACAAGAAAGATGCACAGTCATCTCGGCGTAGTT
GCGCGAGTACTTGTGCAAGTACGCCGCTAGCCCAAGGAGCTTTCTTAGTCCCTTGACATCGACTGGCACAGGCCAGTCGGTAATCGCCTTGATCGTTTCG
GGATCAGGGCGTACGCCGTGTTTACCCACGATGCATCCAAGAATTGGTATTTCGCTTGCAGCAAATATACACTTCTTGAGGTTGGCACACAACTTATGCT
TTTGCATAATCTGAAGAACCTGACGAACGTGTGTTCTGTGAACTTTCACGTCCGTCTTCCCATCCATAGCCCGGCTATGGACGAACATATCGTCAAAGTA
AGTCGGTGCGAAATCCCGCACCGGTCTCAACAGATTTGTTACACATCTGTTGAACGTTGCAGGGGCGTTACTTAGCCCCTGTGGCATCACTAGCCACTCC
CATAGCATACCTCAGGGGGTGCTCACTGTTGTGTACGGGATGTCCCGTTCACAAATTAGGATCTGATAGAAGCCATCCATCAGATCCATAGACGAAAAGA
TGGTACTTTTTGACATACCATCTATGATTACGTCCTTTCTTGGTATCGTCGTTTGAGCCGGTACAGTGGCAGCATTCAACTTGTTGAATGCGTGCACTAT
CCGTCATCCTCCTGTGGCCTTTCGCACACAGAAGGTCGGAGAGCTATGTGGGGAAGTTGATTTCCTCACATGGCCCGCTGCTAAGCGATCGGCGAAGAAT
TTGTCGATAGCTAGTACTTGTTCACGAGGCAGTGGCCACTGATTCATGCCACAGTACTTCGAGCCCGGTTTGAGATCGATCTCGTGTCAAGTGCCTTTGT
CCTTAGGCGATTCGCATGGCACGGATTCAAGGAACACATCGTTGAATTCGATCAAATCCTTATACAAAGGATTTGCCTGAAGCGACCCCCAAGATGAAGA
CGTGTATCGTTCAATCCGAGTCTCTCATCGAGGACACTTTCGTCCATCGATGAACTGCTAAGAACCCGTTCGTTCTCAGCAAATACTGTTGCTGACCGAA
TATCGGTCACATACTCATCCTCTGTGACGAGTATGCAGATCTGCTTGACCTTGCCACTACGCAGATCACGCAGGAACCGTTTCGGTTCCAGCATTGGCAA
TTGAGTTTTCTCCGAAGTTAACTTCGAAGACACAATCAGAGCAAGCGTATAAGCGCGTACGCTTGATCCGTCATTGACCAAGACATTCAATGTCTCGTTT
TCTTCCTGGAACTTGTTTCCTCAGGTTGCTGAGAGCCTGTTCTCTCAGCATGTAACTCTTGAGGAATCCTTTCCTCAAGTACGTGGAGACTTATTCCCTC
GACGTCTTCTGACTGTGGCTGTCCAACCACAGTCAGGTACAGATCCTCTACGGTCGACTATCCAGTCGACCTAGGATGACCGTGTTGCCCTTTGGTGGCA
ACCGGTTTCTTCTTCCTAGGATGCTGCCCGCTAGGCATGCATCCATGTCCCGGTCCACTCGACTTATTCGAGTGGTGGACCTTCGGCGCTGGCTGTACTT
CTGTACAGCCGCCGGGAGCTTGCTCCACAGTGAAGGGATCAGCTACACTGAGGTCCTGTGCAGTCGTGCTAACGACCGTACCGCAAGTGAGGCCATCGCA
CTTACTCGCAGTACGTCCACACGCTTGTGGACGCTCCATGACGTTCATCAGATGGCCATATGATGAACAAGCGGCAGGCA