Description :
From Genome Similarity Track
Location :
Scaffold_229:43781- 44838
Sequence
1057 bases(100 bases per row)
CTACGGGCCGGATTAAGCGATATAAAGCTCGACTAGTGATCAGAGGCTTTCTACAACGCATGGGCATCGACTACAGTGAAACATACGCACCTGTTATCAG
ATTTGAGACGATCAGATGCGTGATCGTATACGCGCTGCAACGCGGATGGGCCATCTTGCAGTTCGACGTCAAGACCGCGTTCTTGTACGGTGACCTCGAC
GAGGAGGTCTACATGGAGCAGCCTCCAGGCTTCGGAGAAGACTCTACGCGCTATGTATGCAAGCTACAGAAGAGTTTGTATGGGCTAAAGCAAGCGCCTC
GCGTTTGGAACAAGACATTGCACAAGTTCCTGACGAAGATCGGACTCGAGCGCCTCGACTCTGACTACGGACTCTACGCCAGGAAAGTGGGAGGAGAAGT
CACCATGTTGCTCACGGTGTACGTCGACGACCTACTGCTCCTCGGCCCTAATGACCTTTGCGCTAAGGTTGCTATGCAACTCAGTGAGGAGTATGAACTC
ACATCTCTCGGACCAGTCAAGTATCTACTAGGCGTGGAGATACTGATCGACAGCGAGCGTCGACATGCGGTATTTTGCCAGCGGCAACATATTACGGAGG
TGCTAAAGCGATTTCACATGGAGGGGTGCAACGCGGTTGCAACACCGGAAGCGCTGCGCGCTGAGGTGGTCACAGATGCGAAAGATGACTCCCCGCCCCC
GTACCGAGAGCTCGTTGGTGCACTACAATATCTGGTCTCAGCCTCAAGGCCGGACATTGCGCACGCTGTGCGTAATCTCAGCAAGTACCTGTCCTGCTTC
GACCACACACACTACGCTATGGGAAAGAGGGTGCTACGCTACCTGAGTGGTACTCAAGACCACGGCTTAGTGATGGACATTGTTATTGGGAACGACGTCA
AGCTGACGTGTTACACCGATGCTGACTACGCTAATGACCCTGATGACCGAAAGAGTGTTAGCGGGTTCGTGACGTTCGTCAATGGTAACGTGGTTTCGTA
CGGATCAAGAAAGCAAGAGATTAACGCACAGAGCACAACGGAAGCAGAGTATATTGC