Description :
From Genome Similarity Track
Location :
Scaffold_19:4378- 5688
Sequence
1310 bases(100 bases per row)
GGGGACCGGAGGCGCAACGAGATGAGTAAACTGGTAGGTCCACGAGGAGATCCCAGAATACACCCAGCTTCCGATAAACCAATACAATACAGAGTTATAC
ACAACAAACAGCCGCCACTTATTCTTTGACCCTTGGGCGGTGGGTCTTACGCCAGTCGACTAGGCCGATTCCAGAGTACTGGTCAACTCTGGGGCCTCTC
GTAACGCGCACCACCCTCTAACGAGGGAAATATACACAATCCAATACAATCCTCTCTCACGAATGCAGTCTCAAAGTCAAACACTCAGGGGACAACCGCT
AATAAATCTCCCCAAGCTCAATCAGTAACATGAAATGGGACACCACCCTTACCTACACGCAATGGGCCCAACTAGGATATGGAATGCGTGGATCACTTCA
GACGCTCGAGTAAAAGATCCCCACGCAGATGGACTTGATGATGGTGGGGAGCTCCGCGACGACCGTGTCATTGGCGACCTACGGACCCGATTCCTGGCTG
GCAGTGACTCTCGACTTGCGCAGTAGGGGGTAAAACGAACTCTCTGATTGTTATCTGCTAGATTATCGCTAAGCTCAATATAAAGGCTATTTTCTTCTGG
GTTCTTCTGGGTTCTTCCGTGTTCCTTGCGTGCGATCTTCGTGAATATCTTGACTTGAGTATGCTTGGGGGGGGGTTGTATACGCCGACCTCGAAGTAGA
CTGGATTTTTCATCCCACTCTTCAGTCAGTGACTTCTGGGTACAAATCAGGTCAGTCATCGTCGCTTGGTTTCAGGCTTGAATCCGAGGGTGCGTTTCAG
GGATCCTTGATTCTGCAGCACTTGGGTTCCGGCATCCGGTTCCAGGGGACCAGCGGGCGCGACTTGTGTTGCGAGGCTTTGAGCTTGTTCCGGGTGCGCG
AGGTAGTTTGTGGGTCTCTATCGAAGCGAGGCGGGACGCCAGCTGCAATACGTTCGCAGGGGCGTTTTAGGCATCCCGAGGGTCAACCCGCTTGAGGACG
GGGGCGACTTAGACGTAACACTCGATTCCAGGGATTCTCGTCCTGAAACGCGAGCTTCCAAGTCTGAAGGGCCCATCTTCGATCTCACCACACTCGTTCC
GCGGAACACCGCCGAAGTCTGGCGAACACCATGTCACACGGGTGCAGCCGGGGCTGAATCCATCAACCAGCCAATCAGAGTGCAGATTTCTGCCACGTCA
AGCGACTCACTCCGGCCTCTCGGAAAATCCCGTTTGGCCTCGTGTCATTGGTTTGAAAATTTTGTGACTAGGGTGGGAAATGGTGAAGTACTTTGGTAGT
ACCGTACATA