Description :
From Genome Similarity Track
Location :
Scaffold_223:4377- 6928
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_223-fgenesh-gene-0.1Choline transporter
Pytul_var.sporangiiferummaker-pug3_contig_223-fgenesh-gene-0.4ATP-binding Cassette (ABC) Superfamily

Sequence
2551 bases(100 bases per row)
CGCAGCTGAAGAAGCTGCTCGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCCATTCATCTCGTATGGGCTGCTGATTTTGCTGTTCTGGTGGG
CGATCCTGGTCACGATTTGCTTGTTTGGAGCGGGTGAGACGTCGTCACGGATCGCGACGATCTCAGCAAGCGCGCCGGCATCGATCCGCGTCGAGACCGA
GTCGTTCCGCGTCAACACGACGCTGCGCTGGTTCTTCCTGTATCACGCGTGGGGCGTCTACTGGTCGTCGACGTTCATCCTCTCGATTGGTGAGATGATC
ACGGCCACCGCCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGACCGTGTCACGTCCAAAAAATTGCTGCGTCTCGTGGACCCC
GTGGCATACGCGATCAAGTCAACGTTTAAGTATCATCTCGGCACGCTCGCGTTGAGCGCAGGTGTCGTCGCGCCCGTCGAGCACGTCCGCATGTTCTTCA
TGTACCTCGAGGACAAGAATGAGTTTGACAGCAACGCTGTCACTGAGGTGCTCGCAAAAATGTGCTGCGTAAGTGTCTGTTCATGTGTGCATGGAGAAAA
TCACTGTTTGCGTATGAGAAAACCAACTAAATCGTGAGGTATGCTGGGGTTAAAATCATGTAGTGCTGCATCTGGATCTTCAAATCCTGTCTCAAGTTTA
TCTGCAAGGAGTCGTTCTACATTACTGCGATTCAAGGCACAAGCTTTTATCCGTCGGCGAAGGTGAGTAGAGTTGATAGAGAAATCCGTATGAGTTGCTT
ATGGATAGTTCACTCATTTGTGGACTTGGTACGCAGCTGGCGACGACGTTGATCACGTCGAACTTGCTCCGCGTCGGAGCGCTCAACCGCATTGGCCATG
CGTCAGTATTGCTCGGCAAGCTCATCGTTTGTTCCACGACGTGTCTGGTTGCGTGGTTCCTGCTTCAAGACGTACGTAAACCTCGGTTTTATTTATTTGT
TTCAAGGAGAAACTGAGAAGATCATTTATCATTACTATGGCCACTAGGTGTCGTCGCCGTTGCTTCCGCTGCTGGCCATCATGATTTTCTCTTATGGAGT
GGCGCATGCATTCACAACGGTACGTGCGATGCTGTTGATATTAATGCCATGCATCAATGCTGTTGATGCTGATGCTAAGGGGCAATGCCTGTGATTGCAG
ATCTACGAGACGACGATCAATATGCTACTCATGTGCTTTACGCTGGATGAAAATATGCACGGCGGCAGGGGCAATGCCGCATTTGCACCCGCGCCACTCA
TTCGATCGGTCAACGACCACCTTCGACCAAAGTGGCAGACCACATTGTAAGCGAGTGGGCGAGTGAGTAAAACTAAACGTGACGCTTGTCTTTGATATAT
GGAGAGGAAAAGCAAGTATAAGGAAGTGTAAAGCGACAAAACTCCCAAGCAAGACTGCTGGATCGATCCGTTTAAAGTAATGATAACAACTATGTGTTTT
TTTATGATTGATTTTTTTGTCCATTACGCTCGTGGTTCTGAAAACAGAAAGAAAAAGGCAAGCGACTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGA
ATACAATCGGTGGAAACTGGGAACCAATGAATTTGGTAATGTGTGTATGCATGCTCTTTTCGTTTTCTAACCTCTCTGTGCATTCCTACTCCTTGTTTGT
TGCGACCAAGCGCGAGTAGATGCCGTTGCGCACAAGCAGATCGTGGTGCGTGCCCTGCTCGGCGATTTTACCGCCATTCACGACGCAGATCTTGTCGGCC
TTGCGAATCGTGGATAGGCGATGTGCGATGATGATCGTAGTGCGTCGCTGCGACGCGACGACCATGTCGAGAGCACGTTGTACGACGTGCTCGCTCTCCG
AGTCTAACGCGCTCGTGGCTTCGTCGAGTAGCAAGATGGCTGGGTTCTTGAGGATGGCGCGCGCGATGGCGACGCGCTGCTTTTGACCACCAGAGAGTTT
CTCGCCCTTGTTGCCCACTTGCGTGGCGTATCCGTCGGGGAAATTAGTGATGAAGTCGTGCGCATTCGCCATCTTCGCAGCGTTCACGATCGCGCTTTCG
TCCGGCATCTCCTCGAGGCCGTACGCAATATTCTCTGCAATCGTGCCGAGGAAGAGCGTCGGCTCCTGCCCAACCAGTCCGATCTGTCGCCGCAGCCAGT
GCAAGTTGAGTTCCTTGATATTGTGACCATCGAGCAGCACGTCACCGCGCAAAGGGTCATAGAATCGCTCGATCAGCGAGATGATCGTGCTTTTTCCCCC
ACCGCTTGGACCGCACAACGCCACCGTCTCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGACGAGGTTGTAGTCATTCAGCACAGTCACTTCGTGGC
GAGTCGGGTACTTGAACAAGATATCGCGAAACTCGAGTCGTCCGCGCACGCTGTCGAGTTTTGATCCGGCTTCGGCAAAGGAATCAATGGGCACACTCGC
GTCTACCAATGTGAAAATGGCTGATCCTGCGTGTTTGGCGTTGTCTGCATC