Description :
From Genome Similarity Track
Location :
Scaffold_188:43762- 46678
Transcript NameFunction/comments
Hyaar_Emoy2812187hypothetical protein

Sequence
2916 bases(100 bases per row)
ATTGCTTGCAATACAGACGTTTATGATGCAGACATTATTTGAAAACAGCCGTTATTGTGAGAAGTAGAGACGCTTCTGGCTAAGACGAAGACACAAACCA
TATGACAGAAAAAGATAGAGGAGCAAGCTCTGGAGCTCACACTTTGATATAAGTAATCCAGTTCGGAGAACTGAATCAAGCTGCAAAACACTACACAACA
GCAGCAGTCACTGAAGAATGTGTATGATGCTCATAATGTCTATATTAATCCAGTACTACATACTATACTCAAGCAACGCGATCAGCCTTTGCTAATGGGC
GTTGAGCATTTGCTTATGTGATCGTATTCACCTTTAATCAATTTTAAGCCAATTACGTGCGTGTGTCACAATAGTGACCTGGCCAAAGAGTGACACCTAT
CATGTTAATCGACCTATGAGGGGGGACAGGCTAGATCGTACTTAGTACGTGAAAGGTACACCTAGCCGCGCTATTTACAGGCACACAGACACAGATAAGT
ACGATTAAAAAGTTCGGCATTCGACCTTGCGCAAGTCACTAATAGCTTCAGTTTTCGGGCTCGCAAAGAATTTTTCGAGGGACAAAAATTCATACGAGAA
TACTCCTGAGCACAGGGAATCATATTCCTGTATAAAATGCACAATTGGGCGGGACTAAGTGTCTGAGTGGTGGCAGCCATACGGATGGGTATTTGAAGTA
CCATCCGCATTGGCCGTGTAGGCAACAGAGATCCTGCCAAAATAAAATAGGGAAGTTAACTGTTATTAGACTGAAGAAATCCAAACTTAAAAACATTTTC
TAGGAATTAAACCAACTCTGACCTTCTATTACTTAAGATCCTCAATCTCTTTCTACGCAACTGTCTTTTCTAATTCACGATATAAATAATCCTAAATCGT
TTTTAGTAATGTACAACTTCAGCGTAAAATTATGATTTCTTGATTCTCACACATTAGTTTCGTCTATGTTGAAAACATCTTTAGGCTCTTAGCGAGAAAC
TACCACCTGAAATCCAGGCAATGCTGCATCCATACCTTCCTCATTTGCTAAACCACTCTCATCACTTTTCATTTTGTGACGCTTTTAGCTTCACCCTGTC
CGCTTCGTACGGGTTGCCGGGTTGAAAAGTAGCAACGTACATGCCCACCCATCCCTTTCCTGTCTTTAGGGACGACGCCAAGGAGGTTTCATTCTTCCCG
TCAGCATCATGCGCAGTATGGCAGACCCCGTCCCGGGCGAACCGCCGGCGCATGGGGGTGAACCGCCGTACCCAAGGGGCAGCGGTCCTGCCACGACCAC
TTCCGAGGGGCATTCTCCACCCGGAGACCCTCCTCACCAGATCTCCGATACGGCAACCGCGACGCCATCTTCGGACGGCAGCACTGGCGACCGGCAGCCG
GGGCAAGCTCGGCAGGCGGATTGCCCTGTGACCCCCTCGAGTCCCGCCCCGTCGGCGGCGAAGCAGGCTACGGAACAGACGGTAAACGCGGCGCAGAGGC
ACCAAATGGCGAGCGAGGTGCGTCCACGGAAGATGTTTGCAGCTCTAGTCGCAGCCCGTAAGGCTGATCCGCTGGGCCCCCCACCGGACGCCTGGACTAC
TACTCTCGCTGAACTGTTTGCTAGAGCCCATGAGGCGGTTTCTATTGACGAGGAGTTAGTACCGCCCGAAAAACGTCGTTTTCTCAAACTATGGAGCGAA
GAGAAAGATCTCTTATTCACGTTTTTATGATAAGGCATGCATATGTGGGGAGAGCTCTTTCACTGACTGGACTAGACAGATTACAGCGGCGACTCGAGAT
TTGTATAACACGAGCTGTTCATTCACGCACATTGTACAGAACATGCTCAGCAAGTTGAAATGGGCTCGGTTAAAACCTTTGAATCTATGGACACCTCGCG
GAGAGGGGGCGTCTACGGATACAGCCGCCATACCCGGTTCACCTGGGTCGCAGGTTGCCTACCTTGATTTTATGTTCAATCCGGCGCTGTACAGCAAGCC
TGACATTGCGACGTTGCGGTCGCTCTGCCAGCATCCGGTAGCTGCACGGTGCGGGCTTCGGCTACGAGAGGCGGTGGATGAGGGCGTATCATTAGTGGTC
TCGCGGAGGGAAGCATCGTCAGTAGGCGTTTACCCGACTTTGTAAAAAGCGTTCTCGACTCCAAGGAGCGACTCCGTCTTTACCGCACCATACAAGCCCA
GATGGAAGGCGAATTGGTTTTGCAGTAGCGCAGTGGCACGACTATACGCGTTTGTCTCCAAAGTACGAGCGCCATCAAGGAGTACATGCCCTTGCAGCTG
AACAGTCGAAGGTGAATCAAGACAAGCTGCGAAGCCTGCTCAACGTTGCGAAGACAATTTGTCACGACACTGTTCGGTGTCGGATTCATATCGTTTTTCT
TGACCGCCAGACAGCGAGTCGTTACGAAATGGCGACTATACCGTTTCGAGGGGCGCTTTACAGGGTGTCTAACATGCATCCGCCGGTCAAAGGGTCTGTC
TGGGCACGGCAGCTTGATACCGGAGGCATCCGACTGGCGGCTCAACGAGAGTATGTTGTGGAGCTCCACAATGTCACCCGCTTTACGGACGTCAGTCGAC
TAACAGCTTACTTTGAGGCCCACATTGCCGCGGGAGTTGAGCTCGATGATATGGACACATGCACGCCCAATTCCCTGACGTCTACTGTGTGGAAACTAAC
CGTTAAACTCGCTGGATGTCCTGACTTTTTGTGTGGCGTTGTCCGGCTCATATGGTACGGCAGCACTATAATATTGAAACATCCTGAGGTTGGGAATCGC
CTTCAGTGTTTGCACTGTGGAGACGTCGGGCATCCCATGGCACGGTGTCGCTATGATGCAGATCAAATTCGAGGACCGGGCAGCCGGGTGGCAACGGAGC
AAGAAGTGGCTGGGCT