Description :
From Genome Similarity Track
Location :
contig_11:437590- 439940
Transcript NameFunction/comments
g3111.t1hypothetical protein
g3112.t1hypothetical protein

Sequence
2350 bases(100 bases per row)
TAGTGTGAGCGAAAAGGAATGACGAAACGATAACGAAATCGATGAATTTGTTTGTTGGCGCTGTTTGCTCTCTCTACGCAGGCGCGGTCTACTCACGTAG
ATGATAAAGAGGAATCTGACGCTAGTCAGCACCCAACCTCCCCGTCTTATTAGAAACGAACCCGAGGTGAGCGAATGGATCAAATTGGTAAGCTCATGAA
GTTCTCATGAAGTTCTCCTGAAGTACTTAAGTATGCACCTTGTATACACGCCTAAATGTTACACCCTCCATCACAGACTGCATCATCTTCCACAGGTGTA
TCCATTTCATGTCGGTGTCTGTAGCCACACGGTCATTTGGCATGCTGAGCGCACCTTGTCGAGGAGCTACCCGCCGCCCCTTCGCCTTCCGACGCGCCAT
GAGCTCCACCTCGCGCGTGACGACGGACGCGGACAACAACCTTGTGCTGTCCCCTGCGCAGCCCACGGCCGCTGTGGTGTTTCTGCACGGCTTGGGCGAC
ACGGGCCACGGCTGGAGTGACGCCATGGCCATGCTGGCCAAGGGCCTTCCGCACGTCAAGTTCGTGCTGCCCACGGCCGCGTCCATGCCCGTGACGCTCA
ACATGGGCATGCGCATGCCCGCGTGGGTGCGTCATTGGCCGAAAACGCGGCTCTATAATAGCAGGAGGTGACGTACTGAAGATATGTTATTTTGCCGCAG
TACGACATCAAGTCGCTGGCTCGCGTCAATGGCGACAACGCCGACGGTATCGACGCGTCACGTGACCGCGTCATGGCGATCATCGAGAAGGAGGTGGCCG
GCGGCATCCCGCTCTCCCGCATTGTGCTGGGAGGCTTCAGTCAGGGCGCAGCGCTGTCGCTGTTCTCGGGTTACCAGAGCAAGACCGTGCTGGGCGGGAT
TATCTCCATGTCGGGGTATCTGCCACGTTACAGTGTGAGTGGGTGGACGAAAGGAGAAGGAGGCGGTGTGGGTTATTGATGGGTTTTGTGCTGTGGTAGT
CGTTCCAGTTTGAGCCGGAGACGGCGGACGTGCCGCTGCTCATGTGCCACGGAGAGAGGGACCCAGTGGTGCGCTTCGAGTTCGGCAAGATGTCGAGAGA
GAAGCTCGAGGCGGCGGGTGTTAAGAACGTCGAGTTCCACGCGTACCCGGACATGGAGCACGGCGCCTGCATGGAGGAGCTGGACGGCGTCACCAAGTGG
CTCCAGCGCGTGCTCCCCGAGACGCAGAAGTAGAGGGAAAACGACAAGTGCAGGACTCAACATAAGGGCAAACGTGTTGCTGTGAGCGTCTTTGAAGTGG
CTCTACATTTTTGCCACACTCTACCTCTGCTAACGTCACCAGGATTGCATCATCTTTGGGGGCCCGCAAACACCCGCGAAATCAGATCACAGTCTGTGGC
CGAGGAGCTCCATTCCGGTAGTTACATCGGACAAGCATGGGATCCCTCTGCGCATTTCTCCATTTGCTTCTCGTTGCGCTCTCGTTCAGCAGCTCCAGCC
CCGTGAGGATGGTCGTCGACAAGCAGAACAGCGTCGTGCTATCGGGCGACAAACCCACCGCCGTCGTGTTTTTTCTGCATGGACTGGGAGACTCGGCGCA
CGGCTGGGCCGACATGTTCGGCAGCATCGCCAAGGACATGCCCCACGTCAAGTTCGTGCTACCAACGGGTAGGCGCTGGAAAAAGCCTTGCAACTAATCG
AGTGTGGGAGCTAACGATGCGACGACGTTTGGTGGTCATGTAGCTGCACCTCGACCGGTGACGATCGCAAACGGCCGGGAGATTCCAGCCTGGGTATGTG
CAGCAGCCTTTTATTGGGGTTGTGTACAGTGTTCTCATTGTGTTGTGCAGTACGACATCGAGGCGTTTGTAGGGGGTGCTGGGTACGCGGCGGGGATTGA
CGAGACTCGCGATGTTCTGCAGTCAATGATCGCCCAGGAGGTGAGCCGCCAATTTAATCTGCATGCCGACCGATTGCTGTGACTGGTTGGAGACTGATCA
ACCATTGGCGGGTGTGTCCGACAGGTCGAGGCGGGGATTCCCCGTTCGCGCATTGTGCTGGGAGGCTTCAGTCAGGGCGGAGCGGTGTCGTACTTCACGG
GGTTCCAAACCAAGCAGCCTATCGGCGGCATCATGGTGCTCTCGTCCTTCATCCCCAGAGAAAAGGTCCTTCTTGCTGCTCTCTTTGCGTTGATAGAGGA
AAAAGGGGGAACTGACCCGCACGGTTGTTGCTTTGTTAGGAGTTTGAGTTCGCGCCCGAGACGGCCAATGTTCCGCTGTTGATTTGCCACGGCGACGCAG
ACTCACGCGCTCGCTACGAGTGGGCCCAGAAGTCCAAGCAGAGACTGGCC