Description :
From Genome Similarity Track
Location :
Scaffold_165:43759- 50912
Transcript NameFunction/comments
Phypl_g4552hypothetical protein

Sequence
7153 bases(100 bases per row)
GTACCAACAtgggcaacgcgctgctgctcgcggtcGTGAAGGACCGacaggccgtggcgctggccgacgtcATCCTACCCTTCGACAATCTGCGGCTGCA
TGAGGTCGAGGCGTTCTGGCGCGCGTTCTACGATTCGGCGACGAGCTTTGCGCTGTCCAAGAGCCAATTGCGCTCCATCTGCTGTCGCGCAGTCACCTCG
GGCGTTTCGAGCCTGCAGAGCTCCAATTCACGCGTTTCCGAGTATGCAGACGCAGTCTTTGAGTTGTTCGCTGACCCGCTGACGCAGAGGCGGTGGCAGC
AAGTGCACCCGGGGGCTCGAGGACTGCAGAGTCAGCAGTTTCAGAGCCCAAGCGACAGCTTGGCAGCGATCGACGCACTCGAGTTCCTCTCGGCAATTGC
ATTCATTTCTGCCATTCCGCTGGATGAGAAGATTGACCTGCTCTTTGACTCGTGGGATATGTCGGAGGATGGAGCGCTGGACTTGGATGAGTTCACGATA
TCATTGAAGTCGACGCTATCGGGACTGGCGAAGATCCTCCAGCCGACTTCGAGCCCCATGGCGACGAGCTTGGATCTGTCGGTGGATGAGGAAGAAATCA
TTATGCTTGCTGAATCGACTTTTCGAGAGATTGCCAACTGTGGGGTTTCATTGTCAAAGGATAAAGTATCAGAACTGGAGCCGGCTACTATTACGTGTGA
GCAATTTCGAGAATTCTGCGTGAAGAACAAGCGAGCGAAAGAACTCTTTGATTTTTTCGATGTGGCCGATGCTAGCCTTGAAAAGCGTGTCCTTGATGCG
GGAGAAGAAGGGGCGTCATTGGAgactgctgcaactgctgaGCTGGTGGCCAAACTTGAAAAGCACTCCGATCTAACGGAATCTTCGACGATTGTAGGTA
CGCTGGTGGACGCTATGCAAGATGATGTTGGTGATATGTTCTTAGCTGTGAAGCCGTGGATTGGGGCGATTGTTGCTCCGAGCAAAATCCCAGCACTCTC
TAAAGGAGCGCCGTTGGTCTCGATCAAGCTGGACTGGATATTCGGCTATAGCGCACAAGATTGCAAGAACAATGTACGCTTCGCTGCAACTACGGCCGAT
GCTAAAGCTGGACGCTTTGAAGAGATAGTAtatccagctgcagcagcatgcgTAGTTCTAAACACAAAGTCGATGAAGCAACGCTATCATCTTTCCCACA
CAGATGATGTGCTGAGCTTGTGCCTGCATCCACGTCTCCCCTTAGCTGCAAGTGGTGAAATTGGCAAACAGCCAAAGATTATCCTTTGGGATTTAGATAC
GATGGAGGTTCAGTGCATCCTGCAAGGGTTTCACAAGCGCGGTATCTTGCAGTTAGCCTTCCTTAGCTCTGAAGTGTTGGTATCCATTGGTGGGGACGAT
GACCACGCTATTGCAATTTACGAGTCGAGCAGTAACTGGAAATCTGCAGTACTGAAGGTTTCAGTGAAAGGCAACAAAGCGGTCCCGTTCCATATCACGA
CGAACCCTCGCATACCTAGCGAGTTTGTTACGTGTGGCCAAAAGTACGTTGAGTTTTGGTCCCTTGACGGAAAAGATCTCGTGTCGAAAAAAGGTTTATT
GGGGAAGAAGGGATCTCTCCAGCCTTTTCCTGTGGCCCAATATCTCGAAACAACAGACCAGGCCGTAGTCGTGGGAACAAGCGATGGCTGCTTGTACCTC
TTTGTGGGGAGACAGTTGACTAATGTCGTTAAGGCGCATGAAGGAGCCATTACTGCTTTGTTCTTCTCCTCAGGGCTCTTGCTTTCGGGAGGCAGGGATG
GCCAAATCATTCAATGGGATGATAAGCTGAAAAAGGTAGGCACTCCTTTTCAAATTCAGGATTCACTTGAATCATCGTCACCTTCGCAGTGCAAGGGCAT
ACGAAGTTGCTGCTATTCTCCTGATAGACGAATCATTCTCATCGGCACATTAGCGTCGGAGATTTATGAGCTGGATGCTAAGACTGGACAAAACATTCGG
TCGGAGCCACTTACTAAGGGACACTTTCAAGGGGAATTGTGGGGACTGGATGTTCACCCGGCAAAACAACAGTGTTGTACGGTTGGGGATGATCAGACGC
TTCGCTTTTGGGACTTGGCGGCACAGCACGAGCTGGGATTCCTGGAGTTGCCGATACCAGGACGTGCTTGCGCTTACTCGGGAGATGGTAAGTTCATCGC
GGTTGGGCTGGGTACTGAGGACTCCGGCAAAACTATGAGCGGATCTCAAGCGAAGTCCGCAGTCAATGCGAAGAAACGACAACCTAACGGAGGATTTGTC
GTGTATAGTGCTGTTGATTTAACCTGTGCAAAGGAACCTTGCTTTGATGCGAAACGATGGGTGAGCGATGTCAAATTCTCGCCCAACAATCGAACGTTGG
CAGTAGCGAGTCACGACTCCAAAATCTACTTGTACAACGTGCTTAAGGGTTTTTCTCGGACTCATGTATTCAACAAGCACTCGAGCTACATCACACATAT
GGACTTCTCATTGGATGGAAACTACATGCAGAGTACTTCAGGTGGATACGAGCTGTTATTCACAGAAGCTATGACGGGAAAACACATCACCAATGCCACA
ACCTTTCGAGATGAGTTATGGCACACAATGACAAGCACATTAGGGTGGTCGGTGCAAGGAATCTGGGAAGCAGAAAGCGACGGTACAGACGTAAACGCTG
TCGACCGATCTAACAATAGGAAGCTACTGGCAACTGGCGATGATTTTGGGAAGGTGAAGATTTTCCAGTATCCTTGTGCCTTGGAAAAGGCTTCGTTTCT
CGAGTTGCGTGGCCATGCTTCTCATGTCACCAACGTCAGGTGGTCTCCTGATGATAGCTATATCGTTTCAGTCGGTGGAAACGACAGGTGCGTCTTTGTA
TGGAAACACGACAAGCAGCCCACCGAAAAGGACAATTTCAAGCGGCGTCTCAGTGAGACTGACAGTGACAGCGATCGAATGGATTTACTTGATAAAAGAG
CTGATGATCCTTTGGAGGTGGTGGCTACGAACGATGACATCGGCGATGAATTCATGGCAGTACGACCGTGGCTAGGGGCTATCGTGGCTCCTTCGAAAGC
TGCATCAATGAAAGTGGACAGCACATCTCCAAATACAAGGCTTGAATTGGAGCGAGTGCACGGCTATCAAGCTCAAACTGCCTCAAACAATGCCCGATAT
GATTCAAAAGGCAAGGTGGTGTATCATACAGCCGCGCTAGGCATCGTATTTGACAAAGTGGCTCAACGTCAAGCCTTTTTCAGGAGTcacgatgacgacg
tcgtTGCGATGTGTGCCCATCCGAATGGCACGACGTTCGCGACATCGCAAATGGGCAAGAAACCCAAGATCTACGTCTGGGACTCTGCTAGCGGAGAAGC
CGTATCACCTTGTCTTGAAGGATTTCACCAGCGCTTTGTGAACGCTGTTTCCTTTTCAAGTGATGGCACAAAACTTGGAAGCGTGGGTGGAGATGATGAC
CATTCCATTGCAATTTACAATTGGCAGAGCGGTGTATTATCCGCGCAATCTCGTGGAGAGCGTAATAACGTCCGTGGTATTTGCTACCATGCTGCTACTA
AGGAATGGGTGACATGCGGTGACAAGCATATTCGTTTCTGGACGGAGCAAGGGAAGAACCTCACTTCAAAGAAAGCCATTTTCGGGACGAAGGCGTATCA
AAATGGGAAAGTGCCTTCTGTTTTTGACTGTGTCGTATCGTTTGGACAATTAATCGTTGCCGGAGCCTCGACTGGTCATTTAGTTGTATTTCAAAGCTCA
GTGGATGTGACGAAGGCTGTCCAAGCTCATGCCAGTGCCGTATTAGCACTCTACGCAACGGAAAGGGAATTGATTAGTGGCGGAAAGGACTCCAAGATAG
TTGTTTGGGACTCGCAGTTCAACAAAGTTGCTGCTTTCGATATGAAGGAACACACACTTCAAGGGGCCAAGCTCTTGAATTCAGAAATTCGAAGTGTTTG
TAACAGTAAAGTTTCTCCCAGAGTTTTCTTAGTTGGTACGGCAGGTAGCGATCTACTCGAATTCGATGCTGGTCGGGCTCAGCCAATGCTATCAACGATC
ACTCGTGGACATTGTAAAATGGAGGTCTGGGGGCTTGCTTGCCACCCATCGAAAGCTGAATATTGCACAGTCGGCGATGACCAGACTGTTCGAGTGTGGT
GTCTGGCCAAGAAAATTCAGCTGAGAGTTCAGAGACTTGAATGCGTTGCCAGATCATGTGCACTTACGGATTCGGCTGATATCGTCGCGATCGGTTTTGG
CGGGCGTAACGCGGTCACCGGTCTGTCAAAGGCAGCTCAAGCGAAAACAGGCGGCATTGTTCTGCTTTGCTATAGTGACTTAACGAAAAAGATGTTTGAA
GACCGACCGTCCAAGCAAGCTATCAGCGAAATGAAGTTCTCGCCGAATGGCTCCGTTCTTGCAGTCGGATCACACGATCACAAGATTTATTTGTATCGGC
TTGATCGCAATGGCACCAAGGTCGTGAAAGTAGCAGCCTTTGACAAGCACCAGAGCTACATCACCCACTTAGACTTCTCAGCGGACAGCCAAGTCTTACA
AAGTAACTGCGGCGCCTACGAACTTCTCTTCAGTAACGCCACCACAGGGAAACACATCACGtctgcgagcagcacgaaaGATACTCAATGGCATTCATGG
ACATGCGTACTTGGGTGGCCTGTGCAAGGTATTTGGCCACCGTGTTCCGATGGAACTGACGTAAATGCTGTCTCCTGCAACTCGCGCGAAAACCTTTTGG
TCACGTCAGACGATTTTGGTCTCGTCAAGCTTTATCGCTATCCATGCGTGACAAAGAATGCAAGCTCGGTAGACCACCGTGGGCATTCGTCTCACGTGAC
AAACGTGCGGTGGTCTCACGATGACAGTTACATTGTAAGTATTGGAGGAAATGATCGTTCCGTTATGGAGTGGAAAGTCTTGGGCGAGAATGAACGTGCT
TCAGCAGGCCCTAGACCAGAGAAACAGTTGAGTCTGATGGAACCAGAAGACGCAACGGATTTGTCTGCAGAATCAGAGGAGGAATCCTTTGACGACCCTG
CGGGGGACGAGTTCATGGCGGTGAAGCCTTGGATAGGAGCAATAGTTGCCCCCACCAATGCTGCCACGCCTAACTCACGTGAGCCAGACTTGAGTGTTGA
GCTAGAATGGGTATACGGTTATCAATCAGAGGTATCACAGCAGAATTTGGTGTACAATGCGCAGGACGAGATCGTTTATCACACGGCAGCGGTGGGGATC
ATCTACGATTCCACGAATCATCTGCAAAGGCACCATATCGGACATAACGACGACATTATCAGCTTCGTGCTTTGTGATACCAGACGGAACCTTATCGCAA
CAGGAGAGCGCGGGAAGAAACCAGTCTTGAGAGTATGGGACGCCCACACGGGCGAGCTACGCTGCGAAATGAAGGAGTTTCATACCCGCGGAATCTTGTC
GCTTGGCTTCAGCGGTGACTCAACAAGGCTAGTTAGCGTCGGAGATGATGATGACCACTCGCTGGCAGTTTGGAGTGATGCAAGCAATGGCTCGTGGACT
TTGGCAAAGCTCCTGGCTACAGGCAAAGGCGATAAAGCGGTAAACTGTTTTGCTTGTTTCGGAACAAATGCTGATACCATTATCACTGGTGGTGTCAAGC
ACGTGCTGTTTTGGTCTGTCCAAGGAAAAAACATCGTCTCGAGGAAAGGGGTGGTTGGCAAGAAAGGTAGTTTGCAAACGTTCCCGACCGGTTGTAACTT
TGAAGGAGACTTTGTGACCGGAACCGCAGGAGGCGAGCTGTATGTATGGAGAGGCAATGATCTCTCAAGAACGGTGAAGGCGCATGACGGAGAAGTTCGC
GTCGTGGCCAGTACGAGTTCAACTGATAACCCCGCTGGAAATCCCTCAGTATTGTTATCAGGTGGGAAAGATGGTCGTGTAGTGATGTGGAATGCAGCGT
ATCAGTCACTAAAGTGTTTCGACCTGGACACGATGCATGTCGGGAGCTTTGGTAAAGTCATCAACAGCGTGTTTCTAAACTCAACTGGCAGAAAACTACT
TGTCGGCACTTGCTCCAGTGACATAATCGAGATAGATGTGGCAAGTGGGGGCGTCCTAAATGGTGGCCAGCCGCTATTCTCCGGTCACTTTGCGATGGAA
CTATGGGGGCTAGCTGTACATCCTTCTCAGCGAGAGTTTGTCACGGTTGGTGACGACCGAACATTGCGTATATGGGATATGGAGGCAAAGCGGTTGATTC
AAGCGCGCTTACTCCCTGCTAAAGCTCGTGCGTGTGCATACTCACCTGATtccgagctgctcgcagtGGGCTTTGGCGGTGACAATGGAGTCCGACAGAG
GAGAAAACCGCTGTCCAAGCCGGGGCAAGCGCAATCGAGAGAAGGAGGCTTTGCTGTCTTGCGAGCACGTGACCTGGATACAGAGAAATTGGTGTTTGAA
GATAAACCAGCGAAAGAGTGGATCAGTGACGTCAAGTTCTCGCCCAGTGGAGAGCTTTTAGCACTCGGTTCCCATGACGACTCGATCTACCTCTACGCAG
TGGGTTCGGGGGCATCTgacttcaagaagcgcaagccATTCAGCAAGCACAACAGCTACATCACGCACTTTGATTTTTCAGAAGACAGCAACTACATTCA
GTCCAACTGTGGCGCTTATGAGTACCTGTTCTGCGATACAGCATCCAGTGGTCAAGTCGGCCGGGCGTCGTCTGTGCGGGATGTGAAGTGGGCAACGTGG
ACATGCGCTTTAGGCTGGCCCGTACAAGGAATTTGGCCAGATTGCGCCGATGGAACCGACATCAATGCTGTTtgtgcgtcgtcgtcacgcACAATCCTCG
CGTCTGGAGACGATTCTGGCAACGTCAAGTTTTTCCGCTATCCGTGCATTCCAAAAGGGGTACGTGGTCGAGCTTACAACGCTGTTCCGCTTTGCACCTA
ACATTGAATTTTGTTCTCGCACCTGCAGTCGAAGTTCATCGCGTGCCGAGGTCACTCCTCTCACATTGCCAATGTGCGCTTCAGCTTTGACGACAAGTAT
CTGATCTCAGTTGGGGGAAACGATAGGTCGATTTTCCAGTGGAAGCTGGCGTA