Description :
From Genome Similarity Track
Location :
contig_11:437577- 439927
Transcript NameFunction/comments
g3268.t1hypothetical protein

Sequence
2350 bases(100 bases per row)
AAGGAATTGTAGTGTGAGCGAAAAGGAATGACGAAACGATAACGAAATCGATGAATTTGTTTGTTGGCGCTGTTTGCTCTCTCTACGCAGGCGCGGTCTA
CTCACGTAGATGATAAAGAGGAATCTGACGCTAGTCAGCACCCAACCACCCCGTCTTATTAGAAACGAACCCGAGGTGAGCGAATGGATCAAGTTGGTAA
GCTCATGAAGTTCTCATGAAGTTCTCCTGAAGTACTTAAGTATACACCTTGTATACACGCCTAAATGTTACACCCTCCATCACAGACTCCATCATCTTCC
ACAGGTGTATCCATTTCATGTCGGTGTCTGTAGCCACACGGTCATTTGGCATGCTGAGCGCACCTTGTCGAGGAGCTACCCGCCGCCCCTTCGCCTTCCG
ACGCGCCATGAGCTCCACCTCGCGCGTGACGACGGACGCGGACAACAACCTTGTGCTGTCCCCTGCGCAGCCCACGGCCGCTGTGGTGTTTCTGCACGGC
TTGGGCGACACGGGCCACGGCTGGAGTGACGCCATGGCCATGCTGGCCAAGGGCCTTCCGCACGTCAAGTTCGTGCTGCCCACGGCCGCGTCCATGCCCG
TGACGCTCAACATGGGCATGCGCATGCCCGCGTGGGTGCGTCATTGGCCAAAAACGCGGCTCTATAATAGCAGGAGGTGACGTACTGAAGATATGTTATT
TTGCCGCAGTACGACATCAAGTCGCTGGCTCGCGTCAATGGCGACAACGCCGACGGGATCGACGCGTCACGTGACCGCGTCATGGCGATCATCGAGAAGG
AGGTGGCCGGCGGCATCCCGCTCTCCCGCATTGTGCTGGGAGGCTTCAGTCAGGGCGCAGCGCTGTCGCTGTTCTCGGGTTACCAGAGCAAGACCGTGCT
GGGCGGGATTATCTCCATGTCGGGGTATCTGCCACGTTACAGTGTGAGTGGGTGGACGAAAGGAGAAGGAGGCGGTGTGGGTTATTGATGGGTTTTGTGC
TGTGGTAGTCGTTCCAGTTTGAGCCGGAGACGGCGGACGTGCCGCTGCTCATGTGCCACGGAGAGAGGGACCCAGTGGTGCGCTTCGAGTTCGGCAAGAT
GTCGAGAGAGAAGCTCGAGGCGGCGGGTGTTAAGAACGTCGAGTTCCACGCGTACCCGGACATGGAGCACGGCGCCTGCATGGAGGAGCTGGACGACGTC
ACCAAGTGGCTCCAGCGCGTGCTCCCCGAGACGCAGAAGTAGAGGGAAAACGACAAGTGCAGGACTCAACATAAGGGCAAACGTGTTGCTGTGAGCGTCT
TTGAAGTGGCTCTACATTTTTGCCACACTCTACCTCTGCTAACGTCACCAGGATTGCATCATCTTTGGGGGCCCGCAAACACCCGCGAAATCAGATCACA
GTCTGTGGCCGAGGAGCTCCATTCCGGTAGTTACATTGGACAAGCATGGGATCCCTCTGCGCATTTCTCCATTTGCTTCTCGTTGCGCTCTCGTTCAGCA
GCTCCAGCCCCGTGAGGATGGTCGTCGACAAGCAGAACAGCGTCGTGCTATCGGGCGACAAACCCACCGCCGTCGTGTTTTTTCTGCATGGACTGGGAGA
CTCGGCGCACGGCTGGGCCGACATGTTCGGCAGCATCGCCAAGGACATGCCCCACGTCAAGTTCGTGCTACCAACGGGTAGGCGCTGGAAAAAGCCTTGC
AACTAATCGAATGTGGGAGCTAACGATGCGACGACGTTTGGTGGTCATGTAGCTGCACCTCGACCGGTGACGATCGCAAACGGCCGGGAGATTCCAGCCT
GGGTATGTGCAGCAGCCTTTTATTGGGGTTGTGTACAGTGTTCTCATTGTGTTGTGCAGTACGACATCGAGGCGTTTGTAGGGGGTGCTGGGTACGCGGC
GGGGATTGACGAGACTCGCGATGTTCTGCAGTCAATGATCGCCCAGGAGGTGAGCCGCCAATTTAATCTGCATGCCGACCGATTGCTGTGACTGGTTGGA
GACTGATCAACCATTGGCGGGTGTGTCCGACAGGTCGAGGCGGGGATTCCCCGTTCGCGCATTGTGCTGGGAGGCTTCAGTCAGGGCGGAGCGGTGTCGT
ACTTCACGGGGTTCCAAACCAAGCAGCCTATCGGCGGCATCATGGTGCTCTCGTCCTTCATCCCCAGAGAAAAGGTCCTTCTTGCTGCTCTCTTTGCGTT
GATAGAGGAAAAAGGGGGAACTGACCCGCACGGTTGTTGCTTTGTTAGGAGTTTGAGTTCGCGCCCGAGACGGCCAATGTTCCGCTGTTGATTTGCCACG
GCGACGCAGACTCACGCGCTCGCTACGAGTGGGCCCAGAAGTCCAAGCAG