Description :
From Genome Similarity Track
Location :
Scaffold_37:43757- 73897
Transcript NameFunction/comments
Phypl_g1452hypothetical protein
Phypl_g1453hypothetical protein PHYSODRAFT_554387
Phypl_g1454pyruvate dehydrogenase E1 component subunit alpha
Phypl_g1455U4/U6.U5 tri-snRNP-associated protein, putative
Phypl_g1456hypothetical protein PHYSODRAFT_554382
Phypl_g1457hypothetical protein PHYSODRAFT_554380
Phypl_g1458conserved hypothetical protein
Phypl_g1459hypothetical protein
Phypl_g1460hypothetical protein
Phypl_g1461hypothetical protein

Sequence
30140 bases(100 bases per row)
CGTAAAGGAAGATGCGGCTCGGTTCACAAGCCCAGCCGCATTTTCGATCTCGATAGCATAGGAATAATCCGTGCTTTCGTGAAGTCCACCGCAGTGAACA
AAGGTCAAAGCTGAGTCGGTGTCAAGCAGTTCGTCTCCATCCACGCTTAGAGACATTCGCACAATAGATGCGCCTCCAGTGTCCTAATAACATCAAAGCA
AAGCAAAGCTGTACGAATTAGTGGAGATGATCAACGATACGATGGCCATGTCACCTACCGCTGGAAGCGTCCACTTTAACGCGATCGAGCCTCCTGAAGT
AGacacaagttcaagctgcGGAACTCCTGGACGTCTCGCTTCACTAGTGGTGACTACAATATCGTCAGAGTACGGGCTCTTCCCTTTATCGTTCACAGTA
CTCAACGAGACAAAATACATTGTGGCAAAGCGTAAACCTTCGACACGGCAGACGCCGGCTCCAGTGCCAATAGCGCAATCCTTCGTCTCAATAACGCTAA
TGCCACATTGGACTCCACCACTCAAACAGCAACTTCCACTAACAGAACAGGCCGTCGTCGTACATAAGTTCAAGCTAACATCGAGCGATTGGATATCGCC
ATTGGAGTTCAAGGCGTGAGAACACGTCGAGCAAGCAGATGTGTCATCAAAGCACGAAGTCAACGACTGCAGACGCGCTGAGTACTGCAGCAAATTGGCT
GGAAAGCCACCGGTGTAGAACGGCTCAGAAAACGACAACTCCACGTATCCCCCATCCACTCGGCTCTGGTTGACGTCAGTTGGGGGAAATGGTAAATCCG
GGCCAAACGTTGTAGCGTTGACGCGATTGTCATCAATCCTACCGGTCAACCCGTACTCATTGACCGGAACGATAGAGAATATGTACATCGTGCTGGCGTG
AAGCCCTCCCACAATAAATGAGGTCTTGCCGGCTTCCCTCGACCCGTTGTAAACTAGTTCTGGATTTGCAGTCGCAGCGATGGCGCGCTGATAAAGTAAA
TATCCTACAGGCACACACGATTAACATTGCATCAGGATTCAAGCATTCGATCAAACAATGAATAGAGAGAGAATTGTTACCTGACACGACGCCTCCTCCG
GTATCCTGAGGTCCGTCCCATCTCACAACCAACGAACTCGATCCAAGATCAGTGATTTCAAGGAGGTTCAGCGTGCCGGGTGGCGTCGGATCTGTAGTTG
TAAACGTCATCGTTTCTCCCCATTCGATATCGCCGATGGTAGTGTTCCAGGCAGCTCTGAGAAAGTAGGTCGTGTTCGCTAGAAGATTTCGAACGGTAAT
CTCGCCCGGGTGCACTGATCGTGCAAAGCTCTCGTGTAAAATCCCCGTAGCCAAGAAAATTCCAATCGTGATGCCAGTAATAGTAGTGCCGCCAAAGTCA
GCCGGAGGTGTAGCAGTCACCAGTGCAGTGCATCCcgacacgcccagcagcgttGGACGTGTCGGTGGGGCTGGTACAGCTGCAGTATCTGTTGTCGCAG
TGACCACGTCGCTTGCCAACCCCTCGTTGGTCAGTGCATCGCAGACGACGTCGGCTTGTAGGGCCAACACCTTGAACGAATACGTCGTCGAGGGTAGCAG
TGGATTCCCGTTTGCGTCACGCGTTACTGTGCTTCTGGTCTTTTCACTCGAGCTTGACGCCACAACACTAGTCAGCTTCACAAACGTGGCAtcgcgaaga
agaaagatGTTGTACTGCGCAATCGGAAGGCCACCTGAAAACCACACAAGACAGCATTTAGACTCAGCCAGCTTTCATTCGTCAAGGAATAAAGTACCTG
TATCGAGTGGTTCCTCCAGTACAAGTATGACCGCTCCCCCTGCAGTAGACACATCCAAATGGGAAATTGTGAAATCCAGAGCAAACCGATAGAAAATAGC
TCGACATCTATACCTGTGACTCCAGCTATCAATGGCAATGGCGTCTTGCTTGGATTTCTTCTGTCTCCAGTTCGTACTGAAATGGGGACGCTAAACCCAC
TCTGGACGCCGACTTTGCTGACCACTCTGAGGCAGAAGATGTACACTGTGTTGTGACGCAGCTTGTAGACGGTCGCTAACGAGCCATTGAGTCGATAAAA
CGAGTTGGTGAAAGCTGTGAGAGATGCCTCGCGGTGCTCGACTACAAGTACTGATGATAGCGTTTCGACAGCCAACCGTGTTGTTTCATCCAGGACGAGC
TCCACACTTCCACCGAATCGAGAAGCTACACTAGGGCGTTGCGGTATATCTGGTGAAGGCTCACTGTACGTGCCTACGAAGGtgagcaagctgctcggaG
GTCCAACACCAAGGGCATTTTCTGCCTGCACATTCACAatgcagctgctgggcattTGCGCGATAGTCAGCGCCGCCGATAGCGTATCTCCGTCTCCAGT
GTCGGCTACCTTGACTCCGTTCAGAAAGACCAGATACTTTAAGACTACGGACCCTCCATCATCATCCACGGGGGTCCATTGGATCTCAAGCAACTGAGTA
GAGTGCTCCACCACGCTGATAAACTCCACCTTCCCGGGCACTGTCGCGTCCGAAGTGCTAGCAGTTAATAACTTTGTGATTTCATactcttctccatctt
cagctACAAACTCCACCGAAATTTCATACTTGGTCAGCGGAGAGAGGCCGCCGACACCAATGGGACCTTTTTCATACAAACTGGCCACCGTATTGGTCGT
GTTAGACCCGCAGGTACTCACACTTCCATCCCCACACGTTTTATCGCACAAATACGCGTCCAGTGCCTCGTCCGCGCCAGTAGCGACTAATTGATAGTAG
CAGAATCCATCTCCAGCAATTCCAAAGCCGTGAATTAGCCGCAACCTCGTGGCACTCACGTTTTCCACCATAAAGTCAACACTGTTCGCACTCCCGTCTG
TCCCGGACGGATACCAGTTCGTCTTCTCGGCAGAATTGAAAGATAAGTGAAGAATCAAATCAGAGTGTGCGATATTCTTCTGGTAAGAAGCGTACAGGTC
TGCCGGGTCTCGCGCCACTTTCCAAATGCGGACCTAGCCCCAATATGAGAGCAGTCAGTACCATGTTTTTGCGTAGATAGCACAAATCCCAGCGTCCTAC
CTCATCCATTACACCTTGGAAGAAAGTTGCCTCCTTCCGAATGTTCATGGTATCTGAGCAAACATACAAGTTGAGTCGTTAAATTTAAGTCAGGAAGCAC
CACTCTCGTACCTCGTCCTAGTTGAAGATACGCATACGCTGGAATATTGCAATTTTCCTTGCCAAGTCGGCCAGTAGCCAGTTTTACGCCTTTCATCAAG
ACTGTCACCTCGTTGTTCGCACCAAATACAACCGCTAGATGAGTCCACTTCTGAAGGGGGAGCGCATGTGGAATGCGTAGCTGATTTTGACAGCGTGata
ccagcagctcgctgttcAGGGTAATGCTCAGACTTCCCTCCGAAGTACCATAAAGCAAcaagagctgctcgtcgctggagttCGAGCTCAGATTGTCCAC
ATACACCCAGAATTCGATCGTAAGTGCATCGTTGATCGACAACGAAAGCATCTGCGCACTGCGCACAATCGAGTCGGACGTAAACCGAAGTTGGGTTTCG
ACAGCCGAACAGAGCGTTCGACACTGACTCGGGTTCACGACCGATACTCGTGAACTGTCTGTACATGGATACAGTGTCTTGGTCGCCTCGCAGCCACGAT
ACTGAAGGTCGTCACCTTTGAAGATTAAAATCGTGAGAGGATGAACCATTGGTACAGAAGTGCAAAACGAGAATTGAGATCTTACCTGTGAAGCGTAAAG
CTCGCGACTCGGCACTGTCCGCCTGCTTCACGTAAGCGCGAAGTAGAACGCGTTCTGGAATGGAGTTCGCTGTGTTGACTTTGATGGAAATCATTCCACC
GGTAGCACGAACAAATTCAATCTCTCCAACCAAACTCTCCTGCGTGTAGTCTCGAATCGAGATTGATTTCAAGTATAGTGCGTCTTCCACGGAGACCATG
CCATGAAAAACAATTTCAGCAGTTGCGGCATACGAGAGATCAATCAATGCGTCGACAAATTTCCACTCGCTCTGGGTAACTGCGGTAGAATCACTGGACC
ACAGTCGTCGGGTCTCAGTTGAATTCAAGACCACGTCCGTGCTGATACTCGAGAAGCCTGCCGAAAAATCGTCTAGTTAGCACTTCATGCACAGCTAAAC
AAGCAGATTTAAAAGCACATTCTTAGCGCACCTGATGACATTCGATAACCGAATGAGAGCGTGGAGTTACCCTGGAGTTGTGTCGAAAGACTTCGGTACA
CAGcctcgccagcagcgatggGCTCTTTTTCGAGTGGTTGAGCTTTCGAGATCCATTCGACCTCTACTTCACGGATTGTTGACGCCTCCACACCGAGTTC
TGCAACGGGAATCACATCTTCCGCAAGGCCGATCGCAAAGACCCCAACGGAAAACCTCAAAGTGCCCAAGAAACTACTGTCTGGGGTGACGGAAATGATA
ACTCGTCTTGCAGAATCGATATCATCATCACCCTGGACGAGAAAATAGTAGCGTTGATCGTTTGATGAAGGAAAATGCTGGACACCATCTTGCTTAATGA
CGATTTCATCAACTATCGTCGTGTTTATCGCTACAGCGAGAGTCATAGACTCGATATCTGAATTCGCAGTGATCATCGTCGGTATAGTGATTTGAGCTGT
AGATCCTTGAAGAACTTTTCGGCTGAAAGAGTACGGAGCAGTAAACAAAGGCTGGGGAAGTGAAGGCAGTACTGATACAACAAAATTTTGCACGAAGAAG
CACCCGGAGTTGGTATCACCAACACCTTTCCACTCCACAATTACATCGACGATAAAGGATCCATACTGAATTGGCGCGAAGGAATATCTATCGCCGCTGT
CCACGTTTAAGGAAATGAATGAAGTCGTGGAATTGTACGGCTCCACCTGAACAGGCTCATCATCGATTAAGACGTTGCCCACGCTAGATAAAGACGTTGC
ATCCAAAACGAAGGAGATACTTTTCAAAAGCTGCGAGTCAAGTAAACTGGCACCACCTAGAACCGTAAGTGCGAGCCAAGAAAGGTTAATTTCACTCTTC
TCCCCTTTGCGTAAGACGAGTGGCCCACCGTTCGTCTCGGATAACTCGCAAAAGTAGAGATTGTACGATACCAGGTTGGACGTCCCCGGTGTCCCGTCAA
CATGTTGCACCAAGTGAGAAATGACGACTTCGATGGCGACTCGAGCGGTTTGCTCTTGGCTCTCAGTGATTTTAATTCCACTAAACGAGTCGCTAACGCT
TGTGTCTTTTAGGAGAAAAGCGCACTCGTtgctcgttgaagttgcagaTCCCAGAACTAAAATGCTGAAGGACGAGCAATTGGTGACGAAGATTTCCACG
CTTGCGTTAGCCAATGCTGCCGTATAATTCATCGTCAGCTCCAACGCCTCGCCGGACAGAATGTTAtgcgctccaagaagaaTTGGTAACTCGACACGAG
GAATTACGAACCAACTGAAAGGGATGCTTGCTTCAGCTAGCACAGTGTCGTTGGTATCCGTCATAACAACACGTATCTGCGCCTCAACACGCTGAACACT
GGGCAGTAGCCTCGTCAACAGCGTTTCGTTGCAAAGATGCTTGAGAACTGGATTGTGGGAGCCCCTAACATCTAGGACGCCTATCGATGGCGCTTCCACT
GTGCCAAGGGCATTAGCTACCGAGAAGATTGTAAAGTTCGTCTCACAAAGTGCAGTGCTCGCTCCTGTTACGTTTGGGAGAAGGCCCGAAGCCAAAAGGT
GGAACGGGGCGTCAACTGGTAACTCGGCAACCAAAGGTAGCAATTCCACAACGACAGCGGTAGAATTTGGTTTCTCGTCCGTTCCAGGTTCAGGATCTGG
ACTCGATGATTGTGCGTTGATATCGTTCTCAACCTCTGAAGTTTGTAACTGCGGGTCTTTCTCGATGGTCACGAAGAACATCTTGGAGTACTTGCTCACG
TTTCCTGTTTTCTTAATGCCGACGGTGAGTATAAAGTCGCTTTCACCAACAAAACCGGGCACGATAGAAATCTTCATCGCCGCCTCACGACGCCGCACTC
TCCAAACAGTCACCAGCCTCCCATTCTCCTCCTGTTCCCTTGATGAAGCACCGCCAATTCGCGCCTGCTCGAACGCGCTCGTTGTGTTCCATCTCGCTTC
GACCGACACCATATCAACCTCTTCACTGCCCCCTCGTGCAGTCTCGATCTCTTCCAGAACATCCTCTAGTCGAACTTCCACCGTTTCGTTCGCCAATGTA
CTGATCATACCGTCGTTCGGTAACATAACACCAAGCTGTGAGCTAGACGTCGAATTGCGCTGACTTTTAAGATGCCTAGACGTCGTAGGAAATGATGAAA
GGGAGCGTGAAACGAGTCGCGGGGGGCTCTCAGACTCAGACAAACGTCGAAATGATGGCGTGGTGGCTGACTTGACTGCCACAATCTGTTCGTTCCCCTC
CTCAACTAGGAAAAGCAGGTTGGAACTCATTTGAAGGTCGGCGTGGAACCCACATCGCCCCACCAAATCAAACAAACACTGGCTTAGAATGGCACCTAGa
aggcagcaacaacaatcACATTATGTCAGCCAAAACCTCAACCGTTTACTACAGTTGAGTCCACCATAACTGACCGTTTAAGAGTTCCGTCACAGGTACA
AACCATAGCGACTCGATACCAGAGCTCGCTGTGTCTTGACTGTCCACGAAGGCGATTGATCCAGCCGTCGGAGGTGAAAAAATCGTAGTGGGCAAGTCAT
TCACCGTGGTCTGCACCTCAAAAATCCGAAGCGTTATCgtagctgcagcttcaatcTGTTCCGAAGCAGCCGAGTCAAATCGATAAGCTGCAAACGCTAA
AACAAATGTAGAAGCCTCATTTCGTACCTTGACAGACTTGACTGCAGCTTCGTTATCCAACGGAAGCGTCACCTTTGAAATTTTCTTCCGGAGGATTTCA
CTCGACAGCTCGACCGTCTTCAGCACAACTTGATCGTCATCGTACAAAGTGACTTCAAGAGATCCCGTCGACGCACTTGATGAACTTTGATCGGTAACGA
GATACAAATCAACAACTACAAAAACAATGCAAGCAAATGGAAGTTTTGGTtagaaaaagaaaaaaaaatgggAAGAAAACTACAGCAAAACCTCGCTACC
ATGACACAGATCCCACGTTCGGCCCGAGACACCATCGGCACAGAGGTCAGAAGGGTCCACCGCGCACCCgatcgtggcgctcgtctgGTAGCACGTCCCA
TACGCATTTGTGGCGGCAACAGGCGGAGGTTGGCACACGCAGCCTGATCGCGAAAGGACTTGACTTTGAGCCACCACGGACCGAGGAGCGATGCAGCAGa
gcaacgccagcgacaCGATCAGGTGCTCGAACAtgctccgcagcagcttgttgcggTCAACCGTTTGTGCTTTATGGGGCTTCTTCACAAGGGTGCCCGA
CTCGGAAGCGTGTCAAAGGTCGGGGGATCTTCCTACAACGCAAACCAACGGACCGAAAGCATGGAAAGCACGAGTCAATCGAAGCTGCACGTAGCTTTTT
TTTTACGTTGGCAGCGCCATTAGCCTCCAACACGACGTAGGTTCTTGGGCCCAAGTGACTCGCAAAAGCTCAAACACGATGTCGATACTTCATTGCGCCG
GACACCGCAAGCACCTCGATCATCGAGAGTTCGCTCACGACGTGCGTTGACCTCCCGCTCTCCCTCTCTCCGTGGGTCTATCGTGTTCGTTGTGCGCTGC
GTGCTGAACAGGCTGCGAGTCGCTGGATTGATCCGAAGAGTAAATTTGCTTGCCTCCTGGACGTCGGGTCAAGACTGGAGAGTCACCCTGGAACTGTCCG
TCGCTCCCAGTCTGCAGTTCATTCGCACTCACTGCGCCCAATGCGTTGGATCCGAGTCGCATGAAGCCGCCACGGCCCGAGCCATTGTaacagcacgcgc
tccacctcgAAGCAGCAGTAGGCGCAAGAAGCAAGCCACCTCCGGCCGGCTGGCTGGCTGAACCCAAGCAGAACTCGGCTGGGTGTGTGAAGACCTCCAT
CGGGCTGAACCAGTGGCGCTTTGATGCCTTGCATTGTTCTAGCCACAGGTGAAGGCcgcagacgaagacgtggcATTCAGATAGAGAAGCGGCCCGACCT
GGACTCCTCCACCCAGCGCAGCCGTCAAGTCTTCCTGGTCGCCACTGTCTCGGTCAATTGGTTCGGGCTCCGCTGCAGAAAGCGATGACGCCAAGTTTGC
GCTCCACTGAAAATCGCCGCCCTGTTCGTCTTGCGAGCTCGGAACCTGACGCACTACTGGACGAACTCACCCCGGCTGCATAGGCCCGCGCTCGCGCGTC
TCATGCCATTCCGCCGCGAAAGCGCCGTTCGTTACCGAACTCACCGCGGCTGGCGACTATTTTCTATCCTTCGAAAGTGTTTTTTTGGCGTTATCGTGTA
TGCGTGGGCGCTGAACACTGAACAGTGATCAgcggcaagttgaagtgcgccGCCCAATCagaagcgccagcgccgctcGGAACGTTGGGCAAGAGCTACA
GGTACCGCCCAAAAACTTTGGCATCTTCAACTTTTTAGTTTATAGAGGCTACACAAATCAAGTCAAGTACCGAACGTATCTGTTTATGTGCACCTCTGGA
AATAGATTCTATCGTATTAAACAGGGTATTGGATAATCATGTGCCAAAGTTTATGGGCGGTATCTGTACATACTTGTTTGTTGTTGACCTGGACTGCGCT
TTGAGTTGACCTGCGTCCAGCGGCTCCCCGAGGCGTTCGAACGCAGCTCGCGGCCGTCAGTCGCCATGGGCTGTCTCGAGCCCCGAAACATGGCGCCCAc
aggaggcggagacggtATCGTCGGCGGAGTCTCCGCTCGCCACCTCCAGGTACGTCAGCGACAAAATAGAAGAGAAACTTGCCCGGCCACCGCTCACTAG
CCGTTCGTGCTAAATAGAGTTCAGGCCCCGCTGACTCGAGCGCACGTGCGTGTGCTGTTACGCCGCGACGAGAAACGCTGAGACCCAAGGGCCGGAAAGC
GCTCAGTTTCGCTTTTGAGCCTCCTCGCGAACGTCGCCGCTGATCGAGGACGAGCCCCGCTATatgcgcagcgtcgccaccgcctcctcctcctccttga
cTACGCCTCTAGACGATTAAAGCAGTGCTCGATCAAATACACACACAGAGACACACGCACAGACCATGACAGACTACAGCCCGTCCACCGGGTCGCCCCT
GACCGGGACCCTGCTGACCCCCCGCtcgctcttgagcttcgGCTCCTCGAACGGGTCGGACGGcaccgacgacagcgacgctgAGTCCATCGAAGACGAA
ATGTGCgtcaaggagcgcgagcgcctcaCGACGGTGGCCAAGCGCATGACCGAGAGCCTCCTGGAAGCCACCGACCTGCTCGGCGGTATCCCGTGGACGC
TCGTGCACGAGAAGCACGGcatctcgctcttccgcgccgacgccgccaacgcaGGAGCCACCAACGTGCCTTGCAACGTCCACGCCGTGTGCAAGTTCGC
GTGCGACATCAAAGACGTCGCGGCGTCGCTCATCACGCCCACGACGGGGTCGTTCAAGCGGATGATGGCCATGCTATCGTCGGATTTcctggacggcgcc
gtggtgctgaACATCGTGGAACCCACGCCGGCCACCCCGCACCGCTACGTCGCGCTCAAGTGGGCCGCCTTCAAGAGCTCGGGTCCGTTCGCCAAGGACC
GCGACCTGCTCATGCTCGAGTACGTCGACATGATCGAGGACGCCCAGGGGCAGATGACCGCCTTCCGCATAATGGAGTCCGTGGACACCCCTGCCGGGTT
CTCCCAGTATGCCGAGTCGCCAAAGTACACGCGCGACCTCGTGCCGCTCATGGGCTTCATGTATCACTCGACCAAGCGGtcgggcgagctgcgcatGACG
TACACGTGCAACTTCGACAAGAACGGCGACCTGCCCGCCTGGGTCGCCAACTCGGCCATCCAGTCGCACGTGGAGAAGTGCATCAACGGCATTCTCAAGT
ACACGGAGAACTTCCGCGTGGGCCGAGAGGAGATCGTGCTTCCGCAGCAAGTGGTCCCCATGAGCGAGCTCGATCACTGCCGCATCTGCTCCAAGAAGTT
CTGcgtgcgtcgccgccgctacaACTGCCTCAAGTGTGGCGaggtgtgctgcagctcgtgcagctcggtgCGTAGTGCGCACGTGCCGGAGGTCggcgag
cgccagcttcgtGTCTGCACAGCGTGCGTCATCGAAGCCCGTCGATCCTCGCGCAACACCGCCAGCGGCATGGAGCCGCCTAGCACTCCGTCGTTCAGCT
CCACGGGCTCGACGAACCAGTTCTTTCCGGACACGAACGAGAGCACACGCGTGCTTGGTCGTGCACAGAGCTTCTCCGTCGCCAGCGGCGAAACAAAGCT
CGAGGTTCCGAAGCGCCGGTCGTACGACAACCTTCTCGACCCCGTGCGCTCCCGACTCATCGAGTACAAGACCTTTTCTGCCGGTTCGGAGGAGGGTCAC
GGCGCCAGTTCGATGGGCTCAGCTATCGGCGTGCCCAAGGCCAGCTTCCCGAGCCGGTCCTTCAGCGACGGCCTCGTGATGCGCAACAAGGCGCTCTTTG
CGGCTAAGCGCCGAGGCAGCCCGGCGGACCTGGCCATCTCGATCGAGGCCTTCCGTCTGCACCAGATGCGCATGGGCAACGCTGAACGGCAGCCCGAGGA
CGGctcggacgagaacgacaacacggacgacgagtccACCGCGTCGTGTTCGTCCGCGTCGCCCACGTACTCGATCACGAGACCGTCACCTCTGCACCGA
CGCACGTCGACGCAGAGTTCGGCGAGTCTTCGCTCTGGCCGCTCCCGCATCCAGATCAACAACGAGAGCAACCAGGAGGAGTTTCCCACAGGtgacgacc
accacgagaAGTTCGAGTTCACTGAGGCGATGACACGCGCCAGGAAcatcatcgccgccgccaactACGCGAACAgcttggcgcagcaggcccGACAGCT
CTCGCACTACCGCGTGGTggcactgcagcacgagcacgagttCATAGCGCCCGTGCCTCGAAATGACGGCAACAACGGTGCAGTGGTGCGTCGTCGACCC
CGTCACCGCCACCACGGCAGCGACTTCGAGGGCGCCGGAGCCGTGCTGTACTCCAACTGAAGAACGCTGTCCGCTCCAACCTGTTGGAAGAAATATGACG
ACGAGCgatgcagaaggaggagtATCAAGAGGCCGACCGTGAACTAGTTAGTGGTGCAGTAGTGTAGAAGAAATGATGTGCGGCCGCAAGTAAGTAGTAC
CAGTGCACATGTGAGTCAGTATatggacgagaagcaggcACACGCGTGGAAATAGGAGGCGGAGGAAGCCACGGCCAAAGTGAACTTGCATTTATTAGTA
TCGTAAGCTTCAACATGGGAATTGAGCAGCTTTAGGTTTTACTTCGAAATAATTGATCCCTCTCCTATCTTTCGTATTGTTTCCTAGTGTCTAGCACCGC
AGCAAACGTTAAAGTGAGGCCCGTCGGCATAGTCTCAAACGCGGTCGAGCTCCACTTGAACAATGTGGCTATAAGAGTGCCGTGTCAATTGATGGATGGT
TGTCGAGACGATTGAGGTGGTTGACGGGTGCAACACGACGTGAACGCGGTTTATGCATTCGTTCCCGACGGGATTTGCATGTTCGCGATGCGTGGCACCA
ATGTATTCCTACGCACACCCACCACGCACCTGGCATCCAGCTTTCACCCGACACAGAGAGAAGCTGTGGGATCGGCCCTGGAAATGAAACCACACGCCGA
AGATTCATGCGAGAAGGGCGGGATACGGCAAATGAGGTCGCGTTGGGCGTTTACATATTCAGCCGGTATTAATGGGGTCGCGAAGCTTACGAGACTGTTC
CTAGAGCTAAGCGTCGATGCCAGCCGGGTTCTAACGCACTACACAGCGCACGCAACGCCATGCTCGCAGCGAGCCGAAATAGGGAGGAAGTGCAGggcga
cgcagcgcagcttcTACCGCTTGTCGAGGCGCTTTGTCCTGAAGAGGGGTGGTGATCCTCTCGCCGCTTCTGAATCCTCCTTGCTGCACTGAGCGCTtac
tgctggagcttgccGTTGTACAGGCTCTTGGCGTAGTCGGGGAAGCGGATGAACGGCGGGTACACGTTGTTGCCCTTGCCGTCCGAGTACACGTCCAGGA
AGGCCGTAGTCACGTCAGGCTTGctcgccgccttggcctccttggtGGCCTTGACAACCTCCGCgcgcaccttcttctccaggtccttgATCTCGTCAGC
CGTGGCGAGCTCAGACTCGATcatgcgcttcttcaccagctcAATGGGGTCGCGCGAGGCACGCATCTGCGAGATCTCGTCACGGTTACGGTACGTCACG
CCGGGGTCCGACATGGAGTGGCCGTGGTAACGGTACGTGTTCATCTCCACGAAGATCGGGCCCTTGCCCGATCCGCACCAGTTCTTCAGGAACTTGGTGC
ACTCGCGCACAGCGAGCACGTCGTTACCGTCGCACTTGATACCGGGGATCTTGTTGCCCATGGTGTAGTAGTCCGTGTTGTTGGACGAACGCTGGGCGGA
CGTGCCCATGCCGTAGTGGTTGTTCTCAATGCAGAAAATCACGGGCAGCTTCCACAGGGCAGCCATGTTGGCGGCCTCGAAGACCTGGCCCTGGTTGGAG
GCGCCGTCGCCGAACATGGTGATGGCGCACGGCATCAGGCCCTCGCCCTTGTGGTTGTACTTGCTGGCGAAGGCCAGTCCCGTGCCCACGGGCACCTGAG
CGCCGACGATACCCTGACCGCCGTAGAAgttgttcttcttgttgtAGAAGTGCATGGAGCCGCCCTTGCCGCCGGTGGCGCCGGTCTTCATGCCGAAGAG
CTCGGAGAGGACGTCCTTGACCTCGGCACCACGGGCGAGCATGATGCAGTGGTTACGGTACGAGGTGATCCACGAGTCGGTGCGCTCCAGGGCGGCCTcg
acgcccgtggccacggcctcctgGCCGTCGTACAGGTGGCAGAAGCCGCGGATGGTGCGGGCCTTGTACTCGTTGTCGTTGGTGATCTCCATGCGGCGCA
TCGTGTACATGAGCGTGTAGTAGCTCAGCATCTCCTCGCGGTTGGTCACGGCGAACTCGGCCGGGCCCTCCTCGAGACCTGCGTATAGGAAACGACCATC
ACTGCGTCAGATACCAAGTCCAGGATCCTGTGGCTGCGATCTGTTGCCGACGTACGGTGCAGCTGGAAGGGCGTGGAGAAGTCGAACTTGGCCTCGCCCG
acgcgttggcggcggcgctgaaggcgcgcgaggcgggcgcggcggcgcgggccagcgcggcggtggAGCGGCGGAGCATCATCATCCTGGAGACGTGCGG
GTGTCGGCGCTTTCCTTTCTGCTTGGAGGATTGGAGAGTGAGACTCCAAGCAGCGTGCGCCGCAAAACCGCGCAAGGCCGGGAATTCGATTAGGTGCGAA
TTCCCCCTCTTTCTCGACCAATGACGTCGCCGGATCAAATCATCCCACACCGTGCAAGTGTGTGTTGTCCCAGTGCAAATGGGCCGAAATGATGGATGAA
GCTTCCGCGGCGGCATGCGCGCGATCGGACGGGCAGCTCTGGGAGCGAGACGTGCAGTCCTAGGCAATGATGCCGCGCAGAGTGCGCAGCCACTAGGTGC
GGAAGGGCTGCTACACCGTGGCGGTGCACGCAGTGGGGTGTCGACGATCGGAGCGGCGATGGGAAGATCAATTAGACTTGGTTTTCGTATGTAGCTCCGC
ATAGACGCCACGAACGCTCCACTTTTGCGGCGGTGCGCGCCTGCTGCCCGACGATTGGCCGAAAGTCGCGCAGTTATCCATCATGTTTTCCAACCAATCC
CGCTCCGAGTACCCGTCCAACCGGGACATCCAATCCGGGACAGCAATTAACCCAAGAGCATCCACAGGCGATGCCcgccacgaagaagcgcaaggccgac
gccgccgcggccgacggcgccgcggccAAGCGCCGCAAGTGCCCGTACCTGGACACGAtccaccaccagctgctggacttcgacttcgagaagGTGTGTT
CCATCAGCCTGTCGGACCAGAACGTCTACGCGTGCCTCGTGTGCGGCAAGTACTTCAAGGGCCGCGGCCGCAATACGCACGCCTTCACGCACTCGGTGCA
GAGCAGCCACCACGTGTTCGTCAACCTGCAGACGGACCGCATCTACTGCCTGCCGGACAACTACGAGGTGGTCGACCACACGCTCAAGCCcgtgcaggac
gcgctgcgcccGACCTTCGAGGCCGCGCAGGTCGCCAGGCTCGACCAGAACCGCATCCTGGCGCAGGACGCCTTCGGGGTCTCGTACCTGCCCGGCTTCA
TCGGCCTGAACAACCTCAAGCACACGGACTACATCAACGTGGTGGTGCAGGCGCTTGCCcacgtgccgctgctgcgggacttcttcttggccaacAAGAC
GGGCAAGGTCAAGtccaagctcgtgctgcgcttcggagagctgctgcgcaagatgTGGAGCCCGCACAACTTCAAGAACACCGTGCGTGTATTTAGATTG
ACGCGTGCGTGCTGCTTTATtggttgctggcgctgactTGTTGCTTTTTGGTGCGGTGCGACGCTGCAGATTAGTCCGCatgagctcgtgcaggagatCT
CGgtgagcagcaagaagaggtTCCACGTCGGAACGCAGAATGAGAGCGTGGAGCTCTTGGCGTGGCTGCTGAACGAGTTGCACAGGGTACGTTTGGAGCT
CGCTAGGCTGGACGCTTAGTAGTGCCGAGGAAACTAAGGGTGGTGCAATTGTAGGGACTTGGCGGGTCCCATAAGCCGGGGACCAGCATCATCCACAAGT
GCTTCCAGGGTTTTGTGGAGGTGACGACGGATAATGGCACGAAAGCTTCGGCGGACCCTGCAGAGCGCGAAGCGGCTGTCTCCACTACGGTGTCACCATT
CTTGTAAGTTGCAGGTCTCATACAGTATTGATTTGCGGGCTGGTACTGATCGCGCTGCTTTATTCGCAGGATGATGGCTCTGGAGTTGCCATCGACGCCA
CTGTTCAAGGATTCTCAAGGTGGAAACATCATCCCTCAGGTGGACTGCATACACCTTTTAATTGTGTAGCTGGAACGCCTACGCTGACAATATTGATCGT
TGTTTTGGAGTAGATCCCGCTGTTCACGGTGCTTGAGAAGTACAATGGCTCGCACGTAACGCACGTGTTGCAAGGCTCTCATCGACTGAAGAAGACCTAC
CGGATCGACTCGCTGCCAGCGTACCTGATCTTCCACGTGAAGCGTTTCACGCGAAACAACTTCTTCACCGAGAAGAACCCCACGATTGTCAACTTCCCCG
TCAAGAATCTGGAGTTGCGTGATTACTTGAAGCTGGATCGGAGCCTTCCGTCGGAGGAGGACCTTCGCGAAAGGTCGATATCCGAGCTGCGAGCTCTTCT
GCGCAAGCACAATCAGTCAACTAAGGATTGCGTTGAAAAGGCCGACTTGGTCGAGAAGATCTTGCGTGTCACGCTGCCGTCTACCAAGTACGTTCCCGTT
GTTGTAGCGTTATAGTTCGCGAAGTTTTTACCCACTTTTGCTGTGTTTTGTGATGTCGCCAGGTACAACTTGATTGCCAATATTTGCCACGACAGTCCAG
TTACTACTGGTCAAGAGGCAGCGCTACAGACGAACCCGCTGACCGAAGGCAGCTATCGTGCTCACGTCCAGAATAGAGTACGCGGCATGTTAACCTGTGT
ACACCTGATCGACAACGCCAATCTAATGATCTGTGTGTTCATGTTTTTATCTGTCACAGGCAACCGAGCAGTGGTACGAAATCCAAGACCTGCACGTCCA
GGAAACGATGCCGCAGCTTATCGGCGTGTCCGAGTCGTACTTGATGATTTACGAGCGGAAGGCATAAACACCCTTGAAAATATAGCCCGCGAATGCGTTC
GTCATACTGCAGACACTCCGAATTGTGCATTCCACGCGACCAGAGCCTCTATCGTCGTAGAGGACACGCTTGGACGGACGCGCGAGAGCGCCACCTGAAA
GTCGGATGCGTTGATTGCTCGCACATCTTCAGCCTTTACGTTAGCTAATTTTGCTCCAAGCTCGCGGATCGGACCCAGAGCAGCATCCTTGCATACAGCC
TTGAGATCGCTGCCTGAGTACCCTTCGGTTGCCTTCACGACGTGCTTGATATCTTTGGATGACAGGGAGAATTTCTGACTACCAAGTAGATGCCGGATAA
GGCGTTCACGAGAAGTATCATCGGGGAGAGGCACTGCCAACAAACAAAACGACATTCGCAAGGTGCCCCATTTAGATACTCGTGTGCCATATTTCCCATT
CCAAGTGGCGTACCATAAATGCGCTTCTCCAGGCGGCGTACGATggcttcgtcgagctcctgaGGAAGATTCGTTGCTCCCATGACGAGAATTCGGTCTT
CTTGTGAtgacgcagctccatcaaGCTCGGTGAAAAACTGCAACAGCAGTCGTAAAAACAGTCAGCTTAATGTGCTATAGTTCAAGTAGCTGGCAATGCT
TCAAATCGTACCTGGTTCTTGATTCTTCTGCTGGCCTCGTTCTCGGACGCTGATCTTGTCGACAGCAAAGCATCGATCTCATCCATAAAAACCACGGACG
GTTGCAGTTCTCGGGCCATCTCGAAGAGCGCCCTAACCAGCTTCTCGCCCTCGCCCACCCACTTGGACGTTAAAGATGACGCAGAAATGCTACCGCAAAC
AACCGTAAGTATGGTAACCAgtcaagcagcaaaagcatCATCTCCAAGCACGGACGTACTTGAAGAAAGTTGCCTTGGCCTCCGTGGCTACAGCTTTTGC
CAGCAACGTTTTTCCTATCCCAGCAGCAAAAGTTGAACCAATATCAGTTCGCAACCGTCATGCTATCTCCACCTACTTCATGCATCCGTCACCTGTGCCT
GGCGGtccgaacagcagcacaccGCGAGGTGGCGCTCTTAACCCCGTGAATAAGTCCGGGCGCAGTGTGGGCAAAATGACAGCCTCCTACTTACACAGCA
TATAACAGTCAGTCTCACCAACTCATTCGGCGCGTTAGCAAGACAGCAGACCTGCAAAATCTGCTTTGCAACTTCCAGTCCAGCAATATCCGTCCAGTGC
ACTCTAGGTGAgtggtccagcacctcgtccagaATCGTATGAGCATGCTCTGTATGCTGCTTCGAGTATCCTGCTCTTTGTTGCTGTCAAAAGCAGCAAA
CCCAGCATGGCAACATTAATCTCCTCCACTATCTACTGCAACGTGCCGTCTGCAACCTCCCAACCTGGCGATCACTAGCCGTACGAGCATTGCTCTCCTG
TGCACTGGACACTGAGACGTCCTACGCAGCGTACACCCAAAATATCCGTCAGAACGCTCCATAACCACGAGCATTTCTCCAAAATCCGGTCATAGCCcac
ctgcgcctgctgcttgcgcgccTGCTCCGCCGTCCAGTCCTTGAGGTactcggcgcgcagcatgTACTCGTTGATCTTGTGCCGCATCTgcgtcttggcc
tcctcgttCGGCAGCTCTGCACTCAAATAAAGTCGCGCAACATCATCACAACGAGTCCGTCCGGGTGGATATTCCCCGCTTCAACGTAcgcgccagctgc
gccatcatcttctcgatGCCCAACGCATAGAGATCCACCGCCTCCGTGTATTTCCCTGCCTTGTCcgccgccacggccgcctcAATGGCCTTCTGGATCC
CGTCCTCGGGGCGACGAGCGCGCCACAAGAACATCGCTCCTCGTTATATTGAAGAATGCGACGATATTCGCTAATATCCGTTTTTTACACGGATAGTATC
CACAATGATATTTCGCACCAACCGTCGAACGAGAGGCGTTAAATCCACGAAGCCATCGATGTTGCGGCGCGCTATCACGCAGATCGggcgcgcgacgacg
cctgCCCGCGGCTACGGCGTGCGCTTTGCCTCGATAAATGGTCCGATCGTGTCCAGCACTCGATGCGCTATCTTTTCACACCGGCACCGTCGTCTAACGC
CTAGAATTGACGGTGGTACGCAGGAAACCAGGTGCGCGCCGGCATGGCGCTCGAGATCGACGGCAAGATCTACCGCGTGGGCAAGAACCAGCACGTGAAG
CCGGGCAAGGGCGGAGCCTACGTCCAGGTGCGTCCTACCGCAGCTTTTTGCGTGGAAATCCACGCAGAATAGCGCGAGAAATGGGCTCACCGGAAGTGTG
TCAATCGTGCaggcggagctcaaggagatcaagacgGGGTCCAAGATGAACCGCCGCTTCCGCGCCGCGGAGACCGTGAACAAGGCGCCGCTGGGCCCGG
ACGAGCCGCACCAGTTCCTGTACTACAACGGGGACCACCTCGTCATCATGCACAACGGGACCTTCGAACAGGTACGGGCGCGGGCTGTCtggtgttgaag
ctgctgggtcgaGATACTAATGTAttgtattgctgctgctggtatttagatggagatcgagcgcgGGCTGTTCTCGGGCCGGCAGTTGGATTTCTTGCAG
GAGGGCAtgacgctgtcgctgcagatcatcgagggcgacgtgctgtggGCCAACATGCCCGAGCACGTGACGCTCGAAGTGACGGTGCGTGCAGTTCATG
GTGCCCATTTCTCTAGTCGTTGCTGAGCTCCCGTGTGCTGAACCCATGTCGTTTTCTCACTCCAGAAAACCACCCCGAAGGGCGTGGCGGACACGGCGCT
GAGCGTGAAGGACGCGACGTTGGAGAACGGCGCTGTGGTCAAGGTGCCGCTCTTCATCGAGATCGGCAACAAGGTCAAGGTGTCCacggaggacggcgcg
tACGTCGACAAGCTGTAAGCGTTGTCTCCACTCgcaggaagcagcagtgATGCGTACGAGCAGAAGAGACGTTGCTGCAattaccccccccccccccatt
gAAAAATGATGCGTCTTCGTGGACAACGTTTGGTCGGATTGACGACACCGAGCTGTCACTCCCATTTGACAGTTTCCTCGCCGCCGACTTAATTTTAGCA
TACTGACACGGCACCGTGGGCAAGGACAAATGCGCGCACACAATTGTAGTTGGTGTGGGTATCGTCACGTCCTCGCCGCCAATCGTTGAAGATCATGGAA
GTAGCGGAGACGCCTTCACTCAGCGGTTTCACTGAAAAATCATGACCAGGTCGCGGCATCACATGCTCCGGTCAGGACGGCATGAGTTCAGGTTTGCAGC
CGGCGCTTCGACGTCGGAGTCGCCCGTGGCGGAAGAGGAAGTACGAGGACTCAGGTGACCTCGAGAGCCTAGAGTCGAGGCCGGTTTTGGTGATcccgtg
gccgtggtcgcAGTGAGAAAAGCGCCTTGGGCATTTGCAATCGCTTTTTGATCGGTCTGACTGGCTGTGCACAGTCTCATCCGTGCGACCTTTTACAGTA
CGGGGCCCGCCAGCGCGACTTCGTGCGTCATTCGCGCTTTGGTCCGGTCCTCCGCACTCGACAGCccttcaacagcagcagtcaTGGCCAACTCCACCGA
GAAGACCTCGCCACCCTCGGGCGACTGCCCGCACGCCGTGGCTTCCACCatcatccagcgccaccgcgacaaccgccagcgcttcgacTCGGCCGACTAC
GAGATGGCGCAGCGCGCCTCCGGGCCGTGCACCGGCTGCACGTGCGGCAAGTGCGCGCCGTCGGACGGCACCGACCTGGAGCGAGAGCCCGAACCTGGCG
CCGCCGAGccgcgcgagcagcttcggtgtctccgtctccagcgcttcgacTCGGCCGACTGGGCCGACTGGGCcctgcaggtgcagcgcgcgcagcaggc
gccgcagacgccgcagaCGGAGTCTCCCGCGACAGAGCCCGCGAACGCCGCACAGATGCTCATGGACCGAcacgcgctcaagacgtGCGCGCTCGTGGGC
CCCGCGCCCGTCGGCAAGAGCGGCGACCACAGCTCTCGAAAGGCATAGGCCTCGGCCGAAGAGGACGTTCGCACAGCAGCCTCCTTGTAGTTACTACCCC
CCTCCCCATTAAAATGGCATAATGTACAGCAATTAATCTACGCTCTTTCGCGCGCGCCGAGCCTCGCAGCGTGTTGCCCCTTAAGTCGGTGGATCATCTG
CGCGCTGAAACAGTTGCGCCCCAAAACACAGCGACTTGATCCTTGCTTGTGCCTCGGGCGGGGGACACCGAGCGCCCAGCGCGCTTGGGGCTCCACTCGA
AGCCGACtttcgtcggcgtcgacaaTGCGCTCGGATGCATCTTTGCACTTGTCGGTCGTACAGACAGACGCGCGAATCTCGAGTCACAAGAtcgagaaga
aaaaaaaaagtatCTTGCGCGTGGCGGCCGCACGCTCGACCGGCAGGGCACGCGGTTGGCAGCCAGTAAGCATCTTGCTGGACGCGGCCTgcgtcgagcg
cttcgccgcGCTTGACTGCGAAGGTCGCTACGTCCACGCgcggacgacagcagccgcACCGGTTCTgctcgaggccgtcgtggccgttTGATGTGTCGGC
TCTCGGCTAGAAGAAGCTGAGACACCGGCGCTGTAGTTACTACAGTACAATAATAAATAAAcgtggccatgctggacTCGCTGCGGAAGCACGCGCTAGG
TTGGTACTGAAGGACTTGTGTTTGACAGCTTCCGTGACGCCGAACGTTCTCGCAGTGATCGTCGTGGCCATCCTGTTCGCCACGTACCGCCTTTCGCGGC
TCGAGGGCGagcgcggacgacgcgggGCAAgcgtcgaggaggacgtgcgTTGTGTGACAGGGATCGGCTCGCTCCCTTGGCTCCTCTGACGCCCTGTGTC
TTTCGCAGTTTGAGAACGTTGTCGGTTTCCTGCACCGACACCTGGACGCCAAGtaccgcgtgctccgcatcgccccgccgccgcattcaaccacgaagct
gcacgcgatGGTGGTCAACGCGGGGTTTGCCATCCCACACGTGGGTACGTGGCGCTGTCACTCGAAGCTTTATCTGCTTGGGTAGTTTCATGGAGCTTTC
GCTTGGTTTGCTGCAGAGGCGGAGGTTTTCGTGGATCAGCAGTTCGCGCTCGACCAGCGCAAACAGAAGCGGAGAGATCGCCAGCCTTTGCCGCCTGTAC
GCTTCCGAGTGTATGCTGCGGATGCGATGACCCCAGTAGCAGAGGTGCCTACTGTTTGGCTGGGCAGGCTCGTTGTCACCGCTAATTGCAATCATCCTTT
GTTATGTAGACTCTTCAACAGCAGAACCTCATCTCCTCGTACGAACAAGGATACCAGCCGAATTAAGAAGCGAAGTTACGCGGTGCAAGGGCTTGGGAGC
TCAACACGCATTGTTACCGAAAACCTGGACCAGTCAAAGATTGAAcatgtcgatctcctcctcggacCCGTCAACTAAGCTTACCTgtgcttctgctgga
gcgccaTTTCTACCTTTGGGTGTACTTGACCTCAGCGTTTTGCTGCTTTCGACGGCCTCTTGTAGCTGCGCATCGGATTTCCAGCCGAACTGAACGACCG
TAGCCGTGAGGTTGTCAACGCTACCTCTCTTGTAGGCTGCCTTTACGATCGCGTCAGCGGCGGCTTTCGCATCATCAAAGTGCGGCAAAGCGAGGTCCAC
TGCATCTTGCTCACTTAGTATGTCCCAGACGCCATCGCAGGCTAGCACGAGGAATAAATCATCAGCTTGCACGTGGAATCGCTTCGCCTCTGGCTCACAC
GAAACGAGTGGCGTCGGAGTCTTCAGAGATCGGTCACCAAATGCACGCGAGACCGCCAAGTACGTAGACGCTTCACGCTGCATGGCTAACCCAGCACCTG
CCGCAGAGTACACGCGAGAGATGCCTGCAATGTTGCCCACGAACCCACCAGCTTTTTCAATTCGTTGCTTTTCGTCCGGCCGATCCGGTTTGTGGTCACT
TGTGAGCGCAAAAGCTCGACCGCCACGACAAATAATTGCACGGCAGTCACCTACGTTCACTGTGTAGAAAGTCAGTTCAGTTGTTGGTTGTTTGCTTCTT
CCCCCCACGCTTTCCACGCTTTCCACAGCGTTTTCACCGTCACTAAAGCTCATGGAGTCAGCTAAGAACCAAACCAGGAGAGCCGTAGAACCATCCTGCG
ACGGATTTTTCTGCAAGAGTTGTGAATCGACCCGTTCGAAGGCATCTTTGAAGGATTTCAAGAAATGACGGTGCTGTTCGTGGCACCATTCCCTTCGCTC
GtctcggcgtgctgcttgtTCGCCATCGATTTGCGTTACCTCGCAGTCTATCTGCGAGATAGCATCCGTGAGTTGGTCGACCAGAACTTGGACCTCGTCA
GCAGAGTCGGGAACGGTGGAATCTGGCTTCATGGCCTTGAGCTCTGCAAATTAGATACGTAGCAATGTTACTTGCTCAACGATGGCATCTTTGCGAACTC
TCTCTTGGGTCGAAAGGTCTCGGGAGCGGTGCAGATCAGCGAACGCTTTGCCTCCGATGCCTTGTCGTACTGCTGAGGCGACAGGTGTCGGGACAAGAAA
TCCGCTGAAAATGTTCCGCCGTGGCCATCAAAAATGCCAAACACCGGTCCAGGGAAGAGCTCGGCGGAAGATACGTGGCGATCTTCATTGCTGGTCTTCA
TTCCGGCCCATGACTCGGTCGCAAACCGAAGTCCAGGAGTTGAAAAgcgttcaagctgctcctgctccgaaGTCCCCACTCGACCAACCTGTTCGTCGCT
GCGTGAGGGGTAAATCGCTTTCACCACGCTGTCTCCATCAGCATCCTCGTCACGGATCTTCCGCTTCGACATACGGGACTTGTGACCCCTGACGGGTGAC
TGAAGATGACTAAGATTTTGTTTATGCGTTTTAGGGACGAGCCGCACTATACAGTCTAATGATCCAGTTTCACAATTTGAATGGATAAAGTCAGTGGACA
CAAGCTATTCAACGGagtgaagttgaagcccaGACTTCACAGATGAAGCTCCCGCCAGTCCACGATCGATATCACACAGCAACGGACAAATGCTGGTTTG
ACAAAAACAATGTCAGATGCAATGCACACAGGACAATATATGTTGACAAGACGTACATGGAGTCAGGGTGAGTAGTAGGCCACTGCATCCACAGGTCCTC
AACTGCTTGGAGAGCACACTCATGAATGACCACCACACAAATCGCGTCGTATCCACCCGCTGAAGACATCAGCAACTCGGTGATTAGCAGCATGCACACA
GACCAAATGCAACATTCAAGCGTACCCCCAGGGAccccagcaagaagaacaccAGGGATCGCCACCGTAGCATCGAGGATAGCCGTCTGCTCGGGTGGTT
CAATTgggacgccagcagcagttcccaTTTCACTACGATGTTCAACGAACCAGAAAAGTATCAGTATGTTAGGGCCACGTCAACAACTTAGAAGTACTAA
GCATACCGCATGAGGTGTCGGAAATGAGAGAAGGCTTCACGAAGTCTCAGAAGTACAGCCCCAATCCTAACATCCGCAGTAGCCCACTACACACGTACGC
ACGATAAACAGGGGTAATGTAAGCACAACGAAAGAATGATAAGAAAGTGAAGATGGCATGGTTTTACCTTCTcgcggccttgagcagccATGGATTCCCA
ATCAATGGGAGTGTTGTGGCGAGCTTCCAGTTCACAGATATCCGCAAAATCCCGCTCGACCTCGAGATTATGGTGGTGAATTTCATCCATCACTCTCTTT
GCCTTCTCAGGCTGCTCCTTTTGCCACTTCATCACTTGACGAACCATGGACACAGTCGCTGATCCGGACGACACGTCTCCCATCATCAAATGGAAGGTGG
GAGGCAATCGAACGGGTTTCTACCAACAAAGACAACAAATTACCGTTAGAACGAACGTTAGCTCCCCGGAGCTGACAGCTTAAATAGTAGGCATTACTAC
GCGGCTAGAAGTGTTCCACAGGCTGCGGTCCGTAATGCATTTTACAATCTCCTCCGGCTTCATCGCGTCTTCGGACGTGAATGTGTTCAAAATTGACGCC
GGGAACCGAGTATACCGTTGTGAACCAAAGCACGCCGCTGAGACATCGAAGCCGCTTCCGATCTGTAGTGCAGTGCATGAAGCAAGCTGTAACTCGACCA
TTCTACATCTGAGAATGCTGTACAGCGTACCTTGCGCTGCACGTAGCAGTGGCTCAACTGGGCAAGGTTGTGCACCAATTCgagatcctgctgctcctca
tCGAAGTTTAAAGTTGGCACAAAGAATGTCACGAGAGCCGCAACCAGCGACGTCACGAGAGCTGCGGAGCTCCCCATGCCTGTTTTTAATGCAACCTGCT
TGCCACCACGCTCTACACAGCTACAATCACACCACTTTCTCGCACACCTAGCAGCTTGAAGTGTGTAAACATACAAACCTCACCTTCCATTGCCGGAGGA
AGGAACACCCCTAGAGCCTTCAAGTTGGCGCGACGGAGGGGCACTTTGGCGTCTTGCAACTAATCCAGTATCCGCACCCAAAACACAAATGTCAACACCG
CATGAATCCAAGCAAGCTTTCACAATGCAACGTCTTTCCTACCCTCTGTACTTGTGAGTAGAAGTCATTATCGCCCCGAAGCGTGACACGCACGCTGGCC
TTCGTCTCCTCAAGCTGATGGAACGTATCGTTGCTCCTGAACGCCTCCAACCCCGCGATGCCGTTCACCGCACACAGCACCGTTTCCTCAATGTACGCGT
TGCGGTGCGAGCCCTCGCTATCATGACACGCTACGTCAGAACCTCCCCCCACAACGCATCATCATTCTGCAGCACTGTCACCTGAGCTGGAACCGGAATC
GTCCGTCGCCATTCTCCTCGATCCAGCCGTCAATGAGCTGATCGAACTGCTCACTCTCCACCTTCAACGGGAACATCCGGCGCCACTCACTCGACGTAGC
AGCAaccgcgtcttcttcgcccCGAGCCTGCAACAACCACCCACAAATACAAAGCTTAGCTCTCCAGCTCGATTGACACATTGTACTCAACTATTATAGC
CtcaccttggcctccacTTGGGAGTAAAACCTCGCGGTACTGGACAGAACGAGCCCCGAGTactgctcgtccagcaccacatACCCtcccacgagcagca
ccttgccaGGCGCTGACACGCACGTGGGGCGGAGACTCGCCATGGTCGTCACTATCGCCACGTTGATACACGACAACTGAGCCGTTACACGGTGTAAGTT
ACACCGGTGGTAACTTACTGAAGAGGGTAGGTATCTCTTTTCATTGGCTGTTACCAAAGTAAAACTGTCTGATTGGCTCCCTGTTGTGTACCCTTAATTC
CGCGCTGCTTTCGCTAATTCCACGCGCCggccatggcgtcgtcctcggcgccGTACGTGGCTCCGCCCGCCTGCGCTCCGCCACCGCCCGCCCCTCACGC
GCTCTATGGATCTCTTGCGTCCAACAGGGAGCACTTCAACCCGCTGCAAcagcgcgcggccgccgcggcgcagGTCCGATCCGTAATGGCCGAATTCCAT
AATCAACTATACAATTTCTCTAACCTGTATACGTAATATCCATAATATGgatgcaggcgctgctgaccCCTGGACGCTCCGTCTCGCAGCGAGAGATCCA
ggccatgctggagaagaacgagatGGCGATCAAGGGCTGGAGCGCGCTCCACAAGGAGCAGCGTACGTTATCACGTCAAGCACCGGAATGGCCTGCTTTA
TTTATTATTTACGTATCTTTATTTACGtatttgttgttgcagcggCCAAGACGAGCCCTGCGGAGCACAAGGAGTGGGTTCGCAGGTGTCTGACCTATCG
CCAGCAGGTTGGGGCCAggctggaggtgctggcgtcgctggcggaCAAGCAGATCGcgcaggaggacgagaaaAGTGGCGGCCATCGGGTGTCCTCGGCG
GCgagacgagctgctgcggggcAGAGCCCGTCGCTGGCAGCTCCGAGCGGATCGGCCCCGCAGAttcagcagcgacagtcGACGTCGGCTGTGCCGCAAC
AGGTTTacgcgccgtcgccgtcgccgatGAATAACAGCAATCCGATGTccatgacgacgtcgtcttcggcgtcCATGGCGATGCCGAATATGGCGGCACC
CACGCCGCCAATGATGTTCCCGGAGCCTCCGATGCCGACGGTTGGATTCGCGTCCACGAGTTCGAGTATGTTCTTCCCCACGGGCCAGATGAACCCGATG
CAGACGTCGGCGGGGTTCACTTCAACCACTTCGATGCCTGTCTCTGGAGTTGCGACGTCGACGCAAGGGTACGCCATGAGCTCTGGAGTGCAGACTTTCA
CGCCAAACGCGTATATGACCTCCACGAGTGGGCCCCCGAGCTCGTCCGCTGCGTTTATGAACCAGCCGAACTACATGATGGGCGCCGGCATGATGACCCC
CCAACAGCAGTTTATGCCAATGCCGATGCCGGTGAACCTGGCGTCCTCTGGCGGCGGGAATATCTATGGCAGCAACAGTTACGGCATGTCCACGGCGTCA
ACATCAGGGAACAACGCCAGCAGTGGAAGTGGCAACGACAATAGTAGCAGTACCAACTTCCCGGTGGATCCCTTTATGACGCCAATTGGATTTGGGCCGG
ATACAAGCTTTGGATCTGCGGGGTTCCCCATGGCTGGTATGCCAAGCATgcccatgcagcagcagatgatgATGGGATCTATGAGTGGAGGCAATTTTGG
AGCGCAAGGAGCATCAATGATGCCGAACAATTTTGGATATGGAGGGATGCCAACGTCGGCAGCGCCAAATATGATGCCGCAGTCATTGCCGACGCACCAG
TTCCAGCCCACGCCTCAGCCTTTCCAACAACAGAGTCAGCTTCCTCAGCACCAGCCACAGCAAACGGGAGCGGGATCTATGAGCATGTCACCCGACTCAG
CATTGTATGGTGACAGCAACGTCAATATCTTCGAAGGGCTGACAGATGATGCGTTCTTTCCAATGCAATGACCAACCTCTCCTCGAAGTGTTCAAGTCGC
CGTTTGTCGGTGCGTCGTTTACTGGGTGTAGCGCTTGTTGAGCTCCTCATAATCTCGATGAAGCAACTCGTATAAccgttctcgtcgtactGATACGTTT
GCAGAGGCTAGCAGGCGCGAGCGGATCGACGGCGGGATATTCCGGGAGGCAGCGCTTACACGTCCGACACACTTGCTTCCGATGAGGATTTCGATTTTAT
GGGCAGCATCCCACGATTTATgcgcggtggcagcagcacgagttTCTCGGTCAATCAACAGCTCAGCGAGCTTGGGCACGCTGAAGATTTTCTGCTTCGA
CTCAACCGACAGTCGAATAGGCGaacgttgctgctgaagcagaagggATTGGTCCACTGTCGCGTTCGAGTCAGAGACACGATTGGGACTGCGATATtgt
ggcgctggcgagctGTCATACGTGACTCGTAAAGTAGCTTGTGGTTGAGTGTGCTGACTGGTGTGTTGCAGCGAGGCCGCAAACATGTGAGCGCGAATGG
GTTCATGCTGCAGATTGTTAAAGTTTTCGAGGATGGATGCTGTCGACTTCAGAGTGACGAATTCTGGCAGTTGTACTGCTGGTGTCGTGTTCACAGCGAG
GTTTGTGAGCGAATATGCGCCCGTTGGGGGGTGAAGCAAGGAGAATCGCAGCTCTGACAGTGCTGGGACTGATACTCGATCGCGGTCTAGTTCTCGATAC
TGATCGAGGAAGGACTTTGTAGTTATGTCGTTTGCTTGGGCTGGATTGCTTTCAGTCACGACAGGATCATGGTTGGCGACGTACTTTTCGTACTGGAAGA
GGTCCTTGTGTGCTTGGAAGAATGCATGGGCAGCAGatgtctgctgctccatctcgatGCCAACGGACGGAATGGCAAGTATGGAAACTAGTGACCTTTT
TGGTACTTTTGGAATTGTACGCGTCGGTTCACTTGGTACAAGGCGAGGATCGAGATGAAGACAGATAGCTCGTTGTCAACGCCGCCCACGCTatcttcat
cgctgtcgaGTACGCCTTCTTTCGTTCGCATCGGAGACGGGTCATACTCACCCGGAGACTTATACGTGGAGAGTATTCTCCCGAAAGTCTTCGCCAGGGA
GCTTAAGCCTGATcaagcccgtgctgctgacacAGCCAAAGGTGGGGCCGCCCAAAAGAAAAGCAGCTTGGGTAGCAACACGAGCTCCAATGCAAGTCTC
CTGTCCGACACGGTCGTGCTGCCATTCGGAGAACACCCAGCTATTCTGCAAGCTCAAGAGGAATGTCGGATTCTCATGAGTGGCAACGACGTTTGTGTAC
TCGAGGACGAGACCGTCAAGGAAGACGTGGTGCAAGTGCTAGGCAacgacgctgagctcgtgTTTCCTGTCCGCAACATCTTCCGCTACCTTGCGATGTT
TATCAAGAACATGGACCTCTTCTTGGAATTCCATGTTAAGGTATTGGACGATGCCCAGAAGTACCGGCAGTTCACAGTGACCAATACGAGATCGCTTGCT
CGGGTCGAAGACGCAAGATGCCAGTTGCCTCTCGCGTTTGGAGCGCACACCGGTTGGCGCTACCTCTGCATGGACCTACAGGACCTCACGAGTCAAGCGT
TTGGCACTCGCTACGTGACCACAACGGAAGTGCGTGTCGGTGGGAATTGTCGCCTGCTTCGCATGTTTTTCCAGGACGAGCGCTATGCCGACTCCGATTT
GCCAGCGCACCTCACCTTCCTCGGCACGTAGCCACATATTTCGACAGACAACAGAGATCAGTAAGACGCGCGGTTGGAAAAAATCAGTTAAGCTTTATTT
TCCCTGAGCTCTTGAGGATCAATCACGCTGCTCTCATGCGCCATACTGTTCTTGCCCAGGAAATGTGATCTAAACAGGTTAGCCCGCCTACAGATACGAC
AAGTTGATTGTATACTGAGGGTCTCGCTGGTTGCGTTGGCGAGATACCTCAGTAAAGATGCGGTGGTTGAGCCACAGCGATTCCAGGTACCGGTATCGAG
CAAGGTCTAGTCGAAGCGGACGTCCACGCTGAAGaccgacgtcttcttcaccatgGGAGTCTACATACGGGCTTGGGAAGTACGCTGCCATGCTGCCTCC
AACAACCGCAATGCGGCACTGCTCAAGCAACAAAACAATGCCCACACCACCTCCACactcagcagcgtggcgagtGCACTCTCCAACTGGTGGTCCATGA
GGCATAAATGCACGAGTGCAGCACGAGTCTCCACAGCATAGGTACTCGCCACAAATCAAACACAGACCCGGGTCGCAGGGTGCCTTATCACATCGCGTGC
ACTTGCGGCCTGCCATCTCGCTGTAAAGCTCGTCGTACTGGATGGGCAAGTCAATTAGCTGCGGTCGAGTAGGCACTTCGCGCAGGATGAACATGCTAGC
AACATAGGCCTCACTGCACCCTTCCGTGTGCTCACACTTGTCGCCAACCTTTGAACTTCCCAGGTGAGTCTTGCTGAGCATGCGATCCATGCACCACTGC
CAGATCTGATCAAACGTAGCGTCTGAACTGCGAGCAATGTCGACTAACGTGGGGATTTGCATCGTCCTGGTAGTAGCGGGCACGCTGGCCTCCTTTTcca
ccaagcagcgccagaaAAGCTTCATGCGGCGAACAAACGCAGCATTATGTGGTAGAATGCGCCGCAGTCGCGACTTCACATCAGAAATGGTTGTGAATGG
TTTCAGCTTCTCAGTTGGGTACGCCTTCGCCATTCGCTGCAAGAGCTGTAGAGCAGCATACGCCTCGGACTCCGCCTCGCCAGAAGCTTCCATCGATTCC
AGAAGCTGTTGAACGAATCCAGGAGCTCCTGCGGAAGATCGAGTGGACGCGGCAGGATTGATAGCACGGCCACTTCTTGTGCAGCGAGGTGCCAAAGCCA
AGACATTTTCctccactgctgctgaatGTCCAAACTCTTC