Description :
From Genome Similarity Track
Location :
Scaffold_194:43754- 44990
Transcript NameFunction/comments
Phymu_g6485hypothetical protein PHYSODRAFT_298493

Sequence
1236 bases(100 bases per row)
gacgtgAGCGTGACGCTAATGGGcaacgtgctggagaagctgcgcgtgctgcagtACGAGCGTGAGttcggcaagaagaagagcttcgcgCCCTTCAATG
AGACGCAGTTCGCCGTCTTGGGGCCCGGCGTGAACGCCAGCGCACagttcaagagcttcctggaCCTCGTGACGTTCCTGCTCAAGAGCTGCAACCAGGA
CTTCGTcgtggacaagtacgacgacCCCAACACGAGCGTCAACAAGCTCATCCTGACGCTGAAGACCTTGGGTTTCCCGCTCGACTTCCCCgcctccaag
ctcaagctaGGGTACGGCGAGGCTGTGTGTGCCGCGCTCGACTTCATCTGCGACCAGGCGCTCGCTGCTCGCCGCTTCGATTGGCCCCGGCCGCAGTACC
CGAAGGAGGACTTTGCGGACGAAGCCGAGgtcgacgatgaagccgaagtgGACACTGccaatgacgacgacgagaaagCGCTGCCAGgcgcagacgaaga
agcagaggagcTCTACAGCGACCTGATCCGCAGTGGCAAGAACGCCGAGGACCAGCACGACCTGgaccagagcttccagcagatGATCATGAGCGAGGTG
GACCCGCTGCTGTGGAAGACGGAACTGGAGCGTGTCGGGCCGAGGCTGAAAGTGAAGaacggcgctgctgctgcagccgcggGCAAGGAGTGGCATGCTC
ATATCGAGCGATCGAGAGAGCACGAAACGGTCATGCGCGATCTGCTGCCGCGTGCGAACGCCCAGCTGCGGCTGCTTGGCACTCAACTCACGGAGGCCAC
CAGCCGCATGGgggcgaaggagaagatgctgaacAACCAGTACGAACATCTCCGACAAGAATACACGgcgctcaaggagaagctgcaggcggcgACGGAG
GTCAGCAAGGCAGGAGCCGACCGCGTGAATGTCATGACCTCGGACTACGCCGAGACGACGGAGCAGTTGAAGGAAACCAAGGGAGTCATGGACGAACGCG
GAGCAAAGATGACGGACACGTCGCCGCTCGTGCACATCAAGGACGCGCTCAAGACGCTCGCGGCTGAGATCAAGAACTTCGAGCTGCGGATTGGCGTTGT
CAGTCACACGTTGTTGCAAGCCAAATGCCGTCAGGCCAGCGCTGCCAATGCTCGACGACGGGGGcgtgacggagctgcagacggaCAAAGCTACCAGGAC
CCGGAGTACGACCCGAGTGATGAGGATTCAAACTAA