Description :
From Genome Similarity Track
Location :
Scaffold_803:4375- 8911
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_803-fgenesh-gene-0.3ATP-binding Cassette (ABC) Superfamily

Sequence
4536 bases(100 bases per row)
ATCAGTCTCGGCCGTCGGCTCGATCCCAAACACCGACACAACGCGCGACTCCACCTCGGCTGATGCGGCCTGCTCGAGCTTGAGCTCGACCATGAGTCCG
TCGCCGAAGCGGTGCTTGAGGTGCTGGATGCTGCCGAGACAGCGCATGCGGCCGCCAACCATGATCCCTACGCGAGTGCACAGCGCCTCGCACTCCTCCA
TACTGTGCGTCGTGAGGATGATGGTCGACTCCTTGCGCGTCGTAGAGATGTCGGCGATGACGTTCCACATGAAGCGGCGCGAGACCGGGTCCATGCCAGT
GGACGGCTCATCCAGGAAGATGATGGGCGGCGAGCCGATCAGCGCGATTGCCACCGACAGCTTGCGCTTGTTGCCGCCCGAAAGCGTCCCAGCGAGCTTG
TGCTCGAAGTCGTCCAGGTTCATCTGGTGCATCAGACCGCGCACGACCGTGTCAAGCTGCGACCGCGACACACCCTTGATGCTTGCGAACAGCTCGAGGT
GCTCGCGCACCGACAGCAGCTCGAAGAGAGCATCGAACTGCGGACAGTAGCCGATCAGGCGTCGCACGTCGATCTGCTGCGTAAGAATGTCGAAGCCGCC
AAGCGCGCCGGCGCCGGCTGTCGGCAGGATATCGCCCGTCATCATCTTCATGGTCGTCGTCTTGCCCGCGCCGTTGATGCCGAGGTACCCGAAGCACTCG
CCCTTGGGCAACCCGAATGACACGTTGCGCACAGCTACCTTGTTACCCTTGTATACCTTGCGGATGCCCGCGAGCTTGACTGCGTCACCATCGGCGCCGC
CGCTAGCCACGCGCTCCGCCTCGCGTTTCACATCCTCGTCTTCGTCGTAGGGAGCGTCCTGGATCGCCGGGTCCTTGAAGATGGCAGCCTTGATCTTGGG
GAAGCTCAGCAAGAAGTCGATGCCGACCGACAGTGTGAAAAAGATGATGGCATCCAGCGCCAGGTAGAGCATCTCCCACCCCATGATGTCCATGTCGAAC
GGACTCGTGGTGCCAGAGGTGCGGCCCATCGACGTTGTGATCTCGTTCAGACTCTGGTTCAGCAATGCCGTCCCCAGGTTGAACAGCGGCGAGAGGCGCC
AGAAGAACTTGAGCACCTTGTTGGCGTCGGCGCTCGAGGTGCTGACAACGTCGAGGATGAAGGACACGACCATGAGCACCACGCCGAGCAGGAAGTTCGC
GATGATGGTGTACGTCTGCGACGAGGCGTGCTCCTTGAAGAAGTAAGTCATCACGTAGGTGAAAGGGCAAATGGCGAGGCCGAAGAGGATGAAAAGCAGC
ACGACAGCCGGGAAGGTCTCGGATGTACAGCTCACGCAGCTGTCGCCCGTGAAAGCTGAAATGTTGAACCCCTTGATCATGACGATGGCGGCAATGAACG
GCACGGCGTAAGTGAGCAGGTCCCACAAGTAGTTGGCGACCCAGAACGCTGGGAGACTCACGCCCGAGACAAGCTGCTGGTGCTTGGAGTTGTGCTCGGC
CTGCTTCTCCTTCACGAGGAAGACAGCAATCGCCGCCGGGAAGAAAGCGAACGCGATCACGATAAATAGGCACGCCGTGAACGCCATGTACGAGCCGAAG
ATGGCCTTCGAAGTCGCCGTCATTGGCAGCGGGTACGAGTTGACCTTGAGTGTCACATTTGCAGCTGTGCTTGAGCCGCTGCCCGCTGCCATCAAGCGGT
ACAGCGCCTGGTCCACGACCGCCTTGAAGACAACTGCGCCATGTGCTGCCGTCGTATTGACAAAGATCTGGTAGCCGAAAATGCGCTGTTGGCCCGAGCC
GTGGACCAGGTATGCGCCGTACTGACCGGTCACTGGCGTCTGCGTGGCAGTCGTCATGTCGGCGTCACTCTTGCCAAATGCGCGCTGGTAGATCTTCTCG
CCCATGCGCAAGCAGTAGCCCTCGGTGCCGCTCACATCTAGATCCGAAGCCGTGTACGAGATGTTGAACACCGTCGGAGATGCAGACGAGTACGGCGGGT
CCGCGATTTCGGCAGACGAGAACTGGTGCGGCTTCCCGCCCTCGAACAAATCATTCATCGTATGCGAGCACCATTGGTCGGTATCGTCGTGGCAAAAGAA
AGGCACGCTGTTGTCGACTCCCGTCTGAAGCTTGTCGGTCGAAAGCGCCAGCTTAGTGTCGGACTTGGTGAAAGAGCTCGACTTCAGCAGCCCAAGGCCA
GCGCCAAGAAGGGTGACGGGTAAAATAGCGCTGAAAATCACGACGCGGCGATCACGCTTGGCAATGCGAAAACGCTTGAGCAGCAAAGCCGACAGGTGGA
CCAGGAACATGACCAACCCGTTCAAGTTGGCGATCGACGGGCCACCACTGCCTCCTGTACTTGCCGCCGGCTTGTCTCCGTCCTTCTTGAGCGTGTGCTG
TTGCGTCTCGTCACCCGCTTCAGCCACCTTGATGAAGACCTCCTCGAGCGTCGTGACCGATATGCCGTACGAATGCACGCCAAGACCATCAAGCTGTCCG
TCGATCGTTTCAAACAGAGACGCAAACGAGCTTGTGGCGTCCACAGGAAGCTGGAAGGCAATCTCGGCACCAACATTGCTGAGCACCTTGGCGTCCGCGA
CGTGCGACGTGACGAGCGAAATCAGCTGCTGCTCGCGGCAGCCATCCTTCTTGACGAGCGTGAAGTTGTAGCCAGCTCCGTAGCGGTTCTTGAGGAACAA
TGAAGATCCGCAGCACCGCAGCTCGCCCTCGGCCATGATGGCGATCCGGTCACCGAGAATGTCGGCTTCGTCCATGAAGTGGGTCGTGAGCACCACGACG
CGGTTCTGACGGTTGTTGAGCAGGATCTCCCATGTGCTGCGTCGACTGTACGGGTCCATCCCCGATGTCGGTTCGTCCAGGAACACTAGCGCGCTGTCGC
CGAGCAGTGAAATGGCCACTGACAGCTTGCGCTTCATGCCGCCGGATAGCGAACCCGCGAAAACGGCACGCTTCTCGGTAAGCCCAACCTCGCTGATCTT
GGTCATCACTACGTTCGTCAGCTCCGCGCCGGAGTAGCCTTTGAGTCGACCATAGAACTTGAGATGCTCCTCGACAGTCATTTCAGCGTACAACACGTCG
TGCTGGAAGCATAGTCCAAGTGACTTGCGGATCTCGCGCATGTCTCGCGTGAGCGAGTGGCCGCGGAAGTACGCGTCGCCTTCGGTAGGGGCTATCATAC
CCGTGAGCATTGAGATGAGCGTCGTCTTGCCGGCGCCATTGTGGCCAAGGAGGCACGTGATCTGATCGCGGAACATGCTCAAACTCACCCCCCGAACAGC
GTGCTTGATACCGCCAGGCACAACGAACTCCTTCTTGATGTTGCGGATGATGAGTGCTTCCCCCGATCGCTCCTGCTGGTGCAGCTCGTGACTCACTGGC
TCAATGTGAGGCGCGTCGACTTCGACACTGGCTTCATTCTCGCCGTACACTACGTCGCTCACTTTGTGCGAGATCTTGCGTGCCCAATAGCTCGGCTGGA
TCGGGAAATACCATTTCTCGACGGTGCCGTACTCACGCGGGATCACACGCTCGAGGTAGAGGCCGACTAGCGAATACAGCACCGTGTCAAAGAACAGCAT
GCCGATCGATACGTCGAAGCTGAAGTTGTTTGCCTCCATACGGGAGTTGCCAAAGTTCATGCCGACACCCGAAGCCTCGGCCGTGGCTAATGCCTGCACG
CCAAACGCTAGCGCCACTGGCGAGAGCAGACATGCGCCGGCCTTGGAACTTTTGGCTGACGTGGACGAAAAGCCGCTCGAGACGAAGTACATGAAAAAGA
AGAGCACCATGCCAGCAAACGCTCCAGTCCGCGAGCGAGAAAAGAGCGTCGAGATGAGAAACCCGAAGGCGAGCACACTCGTGCTGAAGAGGAAGAAAAA
CAGGAAGAGCAACACAAAGTCGCTGTTGCCAAACAGCCCCGCAATGCTCGCAAGCGCTTGCAGGATGGCGCCGATGAAGAAGATCACGAAGTACGTGATG
TACCACGACGCAATGATGTGATTCTCGGCCACTCCAAGGATCTTCATGTACTCGCGCGAGCGGGTCTCCTTCTCTTGGATCAGCACCACCAGCACTCGTG
AAATCGCATACAGATATGCGAGGATGAATACGAGCGGGAACACGCTGCTCACTTGGTCGTAGAATGGAGCCGACACGTACGCCTCGATCGGGAACGGAGT
GACAGTCGACCCAAAGTACGGCTGCGGAGCTTGACGCAGCGGCACCAAGAGCGCCTCTTTCGAAGCCGAATCCATCCCAGTGAACTCGATGAGTGCGTTG
TTCTTGTTGCCTCGGAAGGCGTATGGCATCCCAGCGTTGAGGAAGAAATCACTCTGCAGCGTTTTGAACAATGCCTCATCGTTGGTCGCATTTGCCGCTG
CAGTGGAGAGCTGGTGTTGGCATGTGCCGTTCGTGGACTTGGTCGTGGCGTCCCATACTGGCATGCAGTTGACAAAGCGCGTAACCATTGTCTGCATCGT
CATAAAGCCGCGCGCCGCGTACGCGTTCAGATACGT