Description :
From Genome Similarity Track
Location :
Scaffold_946:4375- 5886
Sequence
1511 bases(100 bases per row)
CTGAAGGCACCAAGTTTAGACCGAGTTGTGGTCCTCTCAAGCGGCCAAAACGGAACCCATCTTCCAATAAGCGACAGCAAGCGAAGGAGGCGTGTATTTA
CTTGTTTTGCCTGCGGCAATTCTGGATTCGCTTTATCTTCTAGAAGAACTCTCCGAATTTCCTCTGAATTTGCTAGCTGTCACAGTCGAAGAAGTACCGA
GCCACGTGACGACCCAATTTGAGCCGCCTTCCGTATGGTAGTCTGGCGTTGTACGTGATTGAACAAAGTAGCAACTAACTCGGTGTTCATTTCAAATCTA
CCTTTGTAATATGACATCAAGTGATTACTGGCGGCGTCAGCCAAGTGGCTTGAGGCAAATATTGTCCTACTCTCATAAATAAACACAGAAATGCCCCAGC
ATTCATATCGCCATTTCCAAACCATTCACTGACGGGTATCTCACCACTCATAGTAACCAGTGGGGTGTTACCTGATTTTCTGTATCGTTATCAAGCATGT
TCGTCATTATGCCAACGGCCGCATTAGCCACCGACATATCCACCCCATCAATATCCTTTAATACAGCGGATTTAGAAATAGTCCAGGCGTGTGTACCATC
TTTTCTATAGTCTTTGGTAAAACGCTCTGCAACGAGCTGCTCATCCATGTTCTTCGGTTGCTCATATTCCGTTATTGTTATAGCTTCAATAATCTCCGCT
TCTAATGAACCCACAGCTAGCTTTGCACTACCTGACTCATTCACTTGTATGCGAGTTTCTTTAAAATACATGTGCGTTTGGGAGAGAACACGCATCCACG
CACACATGCTCTCAACAGGAAGTAGAAAAACACTTGCGTACATATTTGTGTTTGCCTGCCAGCCAAAGGTGCAATTTGTTCAGCGATAAGAGACAAACAT
CGATCTCCACAGTATTAAGCATTTCACAGCATTCAGTCAGAGGTCGCCCGCACTCCCAGAGCTCGTTTTGAACTCGACCTTGGCATAACTTCGCAAAGTT
TGCATCAACCGGTCCATCGATACTTTCAAGTAAACGTTCCATGTTCGCTTCCCTACTTGATCCACACAACGTCTCGTCATTAAAAACACATGTAGCCGGG
TTGGTAGTACAGCAATGAAAAATTAGCAGCACGAGGCGACGATGCTTTGTGAAGTTCTGACCAAGTAAATGCAATTCTGGAGTTGTTAACGGAGTGGTAT
AATTACCTTTTCTATCACCGTATCCAAGTGCGGCACATTATATATATTCTCGGGTTCACATTCATCATATATCATACTCTGCTTCGCCCGTTTTACTTCT
CTTCCCTGGTAAGTCATCGGCAATGTATGCTTTGGCGCCAGGTGTTGATCCGAACCATCTGCAATTTGGTCACAAATAACATTTTTACATTGCGACGCAA
AACATCAGCAAAACAGCGATTTCTGCCGTTATTGCTGAGCGCCACTGCAACGTAGGGATTGCGCTCAGGTAATGAAACCTTCTGGTCAACACGCCCCGTT
GCACCGGGGCA