Description :
From Genome Similarity Track
Location :
contig_13:437412- 438678
Transcript NameFunction/comments
g3035.t1XP_009521306.1 hypothetical protein PHYSODRAFT_478999 [Phytophthora sojae

Sequence
1266 bases(100 bases per row)
GGCGAGGTCTTCTGCGGTCTCACCACGCAGGACTCCGGGTACGTCAAACTGCCCAACAAGGTCGACGACCACTACTTCTACTGGTACTTCGAGTCCCGCA
GCCAGCCCAGCACCGACCCACTCGTGCTTTGGCTCACGGGAGGGCCAGGATGCTCCAGTATGATGGCGCTGCTCACCGAGAACGGACCGTGCCACGTGCA
GCCCGACCTGTCCACGAAACTCAACCCGTACTCGTGGACGAACGAGAGCAACGTCGTGTGGCTGGACCAGCCCACGACGGTGGGCTTCACGTATGGAGAC
GAGCAGGACGCGGACAGCGGTGAGGACAACGTGGGCGAGAACATCTATTACTTCCTGCAAGGTTTCTTCGAGAAGCACCCGGAGCTGGCGGGCCGTGACT
TCTACATCACGGGTGAGAGCTACGGGGACACTACGTGCCTGTGGCGGCGCACTATGTGTGGAAGAAAAACAAAGTGAATGTTGGCACGTCGGCCTTCATC
AACTGAAGGGCATGCTATCGGAAACGGACTTACCCAGGCGCTATTCAGATGCCTCACTACATCGACATGGCGATTGAGAACGCGTACAACATTTCGCTCG
TCGGCATGAAGCAGCTGGACGACATGAAGACGGCAGTGCCAACGTGCATTTCTCTATTGGAGCAGTGCCCGCAGAACGTCACGGCATGCGTGGATGGTGA
GAGCTTTTGCATGGAGAAACTTTTCGAGCCGCTGTTGTCGAGTGGCCGTAACCCGTACGACATTCGTCTGTCTTGCAAAGACCCGAACGACGACACGAGT
TGCTATGACATGTCGTACGTTTCCAAGTACTTGGATGCTCCGAATGTGCGCGCAGTGCTGGGAGTGGACTCGAAGCGTGTGGGCGCCTGGCAGGAGTGCA
ACTCGCAGGTGTACGAAGCATTCGACAAGACTGCTGACCCGGCCAAACCATACAACTCGTATGTGGCTGAGCTGCTGAATAGCGGTGTGCGCGTGCTTAT
CTACGCGGGTGATGCCGATCTCGTGTGCAACTGGTACGGCAACGAGGCTTGGACCCGCGCACTGCAGTGGAAGGACCGGGACGGGTTTAACGCGGCGCCC
GAGACCGCTTTCTTCACGACTAACGGCACCAACGCGGGTGTGGTGCGGTCGTTCAACAACCAGTTCACATTTCTGCGCGTGTTCAACTCGGGTCACATGG
TTCCGCAAGACCAGCCAGCGGTGGCGCTCGAGATGCTCAACAAGTTCCTGAAGAACGAGGCCTTCT