Description :
From Genome Similarity Track
Location :
contig_45:437386- 438412
Transcript NameFunction/comments
g9542.t1hypothetical protein

Sequence
1026 bases(100 bases per row)
TGCTTGTGCAGTAAGCGGTGAGGGCGTCAATAACTCGGCTGCCCAGGACAGGAAAAATGCAGGATAGGCTCCTGTCTCCGTCGCCGCCACGCATTTTCGA
CCCTATGGCGATTAAATAGCCGGTGACTAAGGGCGTGGCGTATTCGTTGACAACGAATCGTCGGACGGATGTTCAGCTTGCCTTGGTCCTGCTGTTTACG
CGAAGCAATGGGGATCGTGACGCCACGATCCTCCACCTTGGAGGCTTGCCAAGCCAGACTGTGTTAGATTACCGCCGGTAATGTATTACATGTAGTGCAA
CTTGTGGATATCATCGGTGCTTGGGTACAAGAGGCACAAGGTAAAAAACCGCTTGCACCGTACGCTTTTTAAAACCAATTCACGAAGTGGGAGCACTGTA
CATTCTGCACGAGTTGTTAAAAGTACATGTACCCGGTATAAGCAGGTTGATCGTTGTATTGTAATGCCGCTCGTTCTCAAACGTTGCAAGTGGAAGAGGC
AACTTCGACATGAGACTCATGGGATTGGCTTTCTTGTGGTCACGAAAACTCGACAATAGTAAATATGTGTGAGCGTAGGAGAATTTATCCTGCTGAAGTT
GGACTATGGAAATTCAACTTTGTATGAATTCTGCACCTTGGGGCCAACCTGCATTTAGTCAAAGAGTGTTCCATTGCACTCTGCTCCGCCTTGAGCCGCT
CCTTACACGGCAACGGTCAACTGGACAGCCGCAGTCACATTCACGTCCACGTCATCTCGGCAGCGAGTAGCTGCATTGTACAGCGCCCACGATCGTGACA
AACCGTCGTCCATTGTCGCGTTCTTGAGGTTGTGCAACGACTCAATCGGGTTGACAGTCGCGGCATTCACAAGAAGCAGCGACAGCCACGTAATGGTTGT
GTTGACCTCAATGACAATCGGCTCCTTCGAAAGGATGTCATTCCACTCCTGTTCCACAAATGTCGACGTACGTGCGAGCTGATTGATCGGAGACACTGGG
ATCATCTGAATGCCGTGAATCGCGTA