Description :
From Genome Similarity Track
Location :
contig_45:437373- 438399
Transcript NameFunction/comments
g10006.t1hypothetical protein

Sequence
1026 bases(100 bases per row)
GTACTGCTTGTGCAGTAAGCGGTGAGGGCGTCAATAACTCGGCTGCCCAGGACAGGAAAAATGCAGGATAGGCTCCTGTCTCCGTCGCCGCCACGCATTT
TCGACCCTATGGCGATTAAATAGCCGGTGACTAAGGGCGTGGCGTATTCGTTGACAACGAATCGTCGGACGGATGTTCAGCTTGCCTTGGTCCTGCTGTT
TACGCGAAGCAATGGGGATCGTGACGCCACGATCCTCCACCTTGGAGGCTTGCCAAGCCAGACTGTGTTAGATTACCGCCGGTAATGTATTACATGTAGT
GCAACTTGTGGATATCATCGGTGCTTGGGTACAAGAGGCACAAGGTAAAAAACCGCTTGCACCGTACGCTTTTTAAAACCAATTCACGAAGTGGGAGCAC
TGTACATTCTGCACGAGTTGTTAAAAGTACATGTACCCGGTATAAGCTGGTTGATCGTTGTATTGTAATGCCGCTCGTTCTCAAACGTTGCAAGTGGAAG
AGGCAACTTCGACATGAGACTCATGGGATTGGCTTTCTTGTGGTCACGAAAATTCGACAATAGTAAATCTGTGTGAGCGTAGGAGAATTTATCCTGCTGA
AGTCGGACTATGGAAATTCAACTTTGTATGAATTCTGCACCTTGGGGCCAACCTGCATTTAGTCAAAGAGTGTTCCATTGCACTCTGCTCCGCCTTGAGC
CGCTCCTTACACGGCAACGGTCAACTGGACAGCCGCAGTCACATTCACGTCCACGTCATCTCGGCAGCGAGTAGCTGCATTGTACAGCGCCCACGATCGT
GACAAACCGTCGTCCATTGTCGCGTTCTTGAGGTTGTGCAACGACTCAATCGGGTTGACAGTCGCGGCATTCACAAGAAGCAGCGACAGCCACGTAATGG
TTGTGTTGACCTCAATGACAATCGGCTCCTTCGAAAGGATGTCATTCCACTCCTGTTCCACAAATGTCGACGTACGTGCGAGCTGATTGATCGGAGACAC
TGGGATCATCTGAATGCCGTGAATCG