Description :
From Genome Similarity Track
Location :
Scaffold_205:43736- 49085
Sequence
5349 bases(100 bases per row)
CCCGTTACACCTGGTAGCACTTCGTAGTCCGTTCAACGACCATGAATGTGTTGGACGATGAGGGGAATGATTTTCATCCCACGCATGAAAGCTACTTCCA
TTTGAGTCAAATCGAATGGGACGCTGTCGAACGCTTGAGTTCAACGATAGGGCAAGAAGCCGTTGGCACACTGCTGTCCGCCCTGGGGCCAGACGGACAG
CACGCCACCATCGCCAAGTTTATTCAGAATGAACTTGACGCCGAGCGGGAAAAGTAACCTTGCTTCACTAACAAGGTTCTCAACAGACAGAGCTGTTGAG
AGAACATGGTGCTCAACAGTTTGAACTGTTAAAACAGCAGCAGGCCACTGCTACCGGGTCGACGTATACACGTCGACCCGAGACTCTAAAGATTGACATC
TTAAAGTACAAGGGAGCCGATGAAGACTCTTTGTTGAGATGGTTCGTGGAACTAGACGATGCCATAAGGGCTCGTCATATCGTCGATGGGGAAATGCAGA
TCGCATTTTCTCAATCGAACTTGGCAGGGCGTGCAAAGACGTGGGCCTTGGGCCGTAAGTTACACGACCCATATGTCTTTGGGTCGTTGGAAGTCTTCAA
GTCCCTGTTAAGGCAAACTTTTGAGCCGCCGCGAGCTGAGTTCAGGGCTCGCTCTGAACTCCTGAGAATCAAGCAAGGTAAACGTGACGTACACTCGTAC
ATGCAGTACATACGTCACCTTACCAGTTGCATAACAGTCGACCCACTGAACAAACGTTGTTCATGCAGGGTCTGACTGATGGTCTTGTTAAAACCTACCT
GTTGGAATTCAACACCCTGGAAGAGGCGATAAGGGTTGCGGAACAGGAGGACTTCAGCATGAAACAGGCTCACGCGAATTCGAATTCCTATCATCCATCG
AGACGACAGGAAAATGGAGGCCCAGAACCAATGGACCTCTGTCACGCGGGGATCGAGAGCTCTCGTGTTAACAACTACAAGAAATTGCAAAATGCAATAG
GTGCCAGAAGACAGGGCATTATGCATACGAATGCAGTGCCCCGAGCGCGGTACCACGTACCGCAGGAAACAATAACCGCCAAGCGGCCAAGCGGGGCCCA
AGGCGTGGGCCCGACGTTGTTGCAAAAAAACGCAACAACGAAACGGATAGCCAAAAAACGGTCAGGGTCAGTAGGTGCGCAGCACCCTACTGATACAGCA
ACGTCAAGTGAGTTTGTAGGCCTCTTGACGAAAGTTGCTTCCAACACTCAGTCATTGTGTGTTGCTGCTTCTGGTAATGAGGTTTCCCACATTACCTTGA
AACCAGAAGTGACACAACGCATGTCGCTTCGAGCTTGGAGCGTCGAACAACTTTGTACAACGACAATCGCTAGAAATCAGAGAGCTCGAATATGTTGAGC
GAGAAATCCCTCCAACGAGGATGACGGTGCGCCTCGCGACAGGCGCATCCGTAACAGTGATGAAACGTGTAGTGGGTATTACCTATACACTGAAGGGAGT
CCAATACAATGGTGACTTCATCATATTAGACTTGGATGACAGATTTAATGTCATCCTTGGACAGCCGTGGCTCAGAAGGTACGAGCCACAGGTCAGCTGG
CATCGACGAACAGTCGATATGCCTGTCACTTGTTTATCAGATGGCCATCTGATGAACGCCATGGAGCGCCCACTAACATTTGGATGTACTACGAGCGAGT
GCGATGGCCTCGCGTGTGGTTAGGTCGTTAGCACGACTGCACATGGCCAGGGAGTGGCTGATCGCCACACCATGAAGCCAGATTCCGGCGACTGCATTGA
GATGCAGGTCGAGCCGAAGGTCCACCACCCGAATAAGTCGAGTGGACTGGGACATGGGTGTCCTCCAAACGGACAACACCCAAGTGAAAATGAACCGATT
GCCAATGATTGGCAATACGATGATCTTAGTGCGATTGGAGAATCGTACGTAGAAGACCTGGTCGCGGTAGCGCAACCACCGCCAGAGGATAACGACGGAG
CAATTCCACTCGTGTCAGATGATGGGATATCCCAAGAGGCTAGCGAGGGAATAAGTCCCCACCCAACTGTGGAAATAAGTTCCCAGGAGAGAACAGAGAC
GTAAAATGTCCTATTCAATGACGGATCAAGCATAGGAACATACCAACTTGATCTGATCGCGCCTCCGAAGACAACTTCGGAGATCACTCAATTGCTCACG
CTGGAACAGACGAGGTTCTTGCGTGATCTGCGTAGTGGCAAAGTCAAGCAGATTTGCGTACTCGTCGCGAAGACGAGTACGTAAACGATATTCGGTCGGC
AATGATATTCGCTGAGAGCGAAAGGGTTCTCAGCAGCTCATCAATGGATACGAGTGTCCTTGATGAGAAGACTCGGATTGAGCGGTATAGATCCCAATCG
TGGAAATCGCTACGACAAATCCTCTCTACGATGATTTGACAGAATTCAGGGATGTGTTACCAGAAACAGTGCCGCGCGAGCTATCCAAGGATAAGGGTAC
TCGCCACGAGATAGATCTGAAACCAGGGTCAAAGTACTGTGTCATAAAGCAATGGCCATTGCCTCGTGAACGAGTACTAGCGATTGATAAATTCTTTGCC
GATCGCTTGGCAGCGGGCCATGTGAGGGAATCTACTTCCCCACATAGCTCTCCGACCTTCTGTGTCCCACAGGAGGATGGCGGATAGTACATGCCTTCAA
CAAGTTGAATGCTGCCACTGTACCGGCTCAAACGCCGATACCAAGAAAGGATGTCATTATAGATGGTATGTCAAGGAGTATCATCTTTTCATCGATGGAC
CTGGTGGACGGGTTCTATCAGATCCTTATGCGTGAAAAGGACATTCCTTATACAGTAGTTAGCACCCCGAGCGGTATGCCTTGGGAGTGACTAGTAATCC
CACAAGGGCTTAGTAATGCCCCTGCTACGTTCAACAGATGTGTTACGAATCTGCTGAGACCTGTGCGAGAATTCGCACCCAGATACTTCGAAGACGTGTT
CGTCCATAGCCGGGATATGGATGGACAGACGGATTTGGAAGTCCACCGACTCCACGTCCGGAAAGTTCTTGCACTGATGCGTGAGCATAAGCTGTATGCC
AATCTCAGGAAGTTTATATTTGCTGCAAGCGAAATACCACTTCTTGGATGCATCGTGGGTAAGCACGGCGTCCGGCCCGATCCGAATAAGATCAAGGCGA
TCACTGACTGGCCGGTGCCTACCGACATAAAAGGACTTCGAAAGTTTCTTGGCCTAGCGGCGTATTTGCACAAATACTCGCACAATTACTCCGAGATGAC
TGTTCATCTTTCTCGTTTATTGAAAAAGAATTAGAAGTGGGCATGAAGTGCTGATTGCCAGCGCTCTTTTGAAGGTATCAAGCAAAGATTGATACGCTCG
CCAGTTTTGGCGATTGCAGACCAAGACAGACCATTTCATGTGGTCTGCGATGCAAGTGATTTTGCTACCGGATGTGCACTAATGCAGTATGACACTGACG
GTGCTGAGCGTGTCGTCTGCTATCAGTCACGTCAGCTGTAGCCGGCTAAACGTAACTACGCAGTCCATGACAACGAACTCCTTGTCATGAAGTATGCATT
GGCGAAATTCAGGGTCTACCTGCTAGGTGATAGACCCTTCATCGTTTACACGGACCATGCGTCCTTACGCACGGCCGTTAACAGTCCACACCTCTCGCAA
CGAATGGCGAGGTGGCTGTCGTTCTTCGCGGAGTATAACTTCTCCGTGGAATATAAGCCAAGACGAACGAATGTCGTCGCTGATGCTCTGTCGCGCCGCC
CCGATTTCGAACCGGCTGCGCAACCCGACACTGGTCCAACCACTGTCGCGGTATTGACGTCGAGTGTCCCGTCGTCAACCTTACTAGAAGACATACGCAA
GGCGTACGATCCGGCGATGGTGCGTTTGATGGATCATCTCTCGCAACCATCCCGTCAATCCCTTAAAAGGTTGTCCCTAGTATATCGATCCTCCAACGGA
TAGTTATACAGTCCACAATGGCTTACTGAATTATACAGCCGTTGCCGGCGACACGCCTCGTGTCGTCGTACCGGACCATGGTGACCTGCGACTGCGTATC
ATGTATGAGTACCACGGTGCACCTACTGGCGGACATCGTGGTCGAGAGAAGACATATCTCACAGTTAGTCGCGACTTTTACTGGCCCCACCAGTATCAGT
TCGTGCGAAAGTACGTCCGCGCATGCGAAGTATGTTAATGAGTGAAGTCAGGTCCTTCACTTCGTGCGCCGTTGCAACCCTTGCCCATTCCGGCAGAATG
CTGGGAATCACAATGGAATTTGTCTTTGGATTCCCCGCAGACCCACACAAGATACAGGTATTCTTGTGTTCGTTGATAGATTCAGTAAAATGGTTCACCT
GGTCGCTGTAAATGAATCTATCAATGCATCGGCATGTGCTCGTGTCTTTATTGACACGATCTTTCGTCGTCATGGGTTGCCTCGTGAACTCGTCTCTAAT
CGAGACCCACGGTTTACTGCGGAATTCTGGCGATCCGTGTTCAAAACACTCGGAACGCGCCTTCAGATGTCGACCTCTGACCACCCTGAAACAGATGGCC
AGACAAAACGTGCAAACCGTGTTCTTGAGGAAATCCTTCGGGGTTATGTCCATTCGTTTACGAATTAGAGCGAATTCTTGCCAATGGTGGAATTCGCCAT
CAACAACTCGGTGCATGCATCGACGACGCATACACCGTTCTTCGTGAATGGCTTACGCCACCCACGCCTACCCACCTTCTTAGAGTGTAACTTTAGTTTG
AGGGGGGGAGGGACTCATTCGAGCGAACGCCAAGTCAGCTCTCACTCATCACGTACTGACCACGAGGTCACTACGTATGACGCCGATGTCGATCACATCA
ACTTCGGTGAAGAAGAGGAAAGTAAGAGCGAGGATGCTCTTACTACCCAGGTCACTGACCTTGCCACAGTGCGCTCCAAGCGCACTACAGCCAAAGACAG
CGAGTCAGCAAATGAATTCATACTGGCTCGCGAAACGGTTGTTCATTTCGTGCAAGATTCCATTGCAGAAGCAGTGGACCGACAAAAAAAAACGCAGACA
AGAATGGAAGGGCAAATGTTCTTTCATTCAATGAAGGTGACCTAGTCCTACTATCCACGGTAAACTTACCTCGACACATAGTGACTAACGTGGGTAGTAA
CAAGTTACTACCCAAGTTCATCGGTCCATTTCGTGTGCTGCGCCGCATAGGCAACGCATACACGATTGAACTGCCACGTAAGATGCGCACGAATCCTACG
TTCTACGTCGGTCGGTCGCCTTGGGCCTTATCACCAGTACGGGACTTCT