Description :
From Genome Similarity Track
Location :
Scaffold_240:43734- 46103
Transcript NameFunction/comments
Phymu_g7378conserved hypothetical protein
Phymu_g7379conserved hypothetical protein

Sequence
2369 bases(100 bases per row)
ATGGCACGCGGAGCAGTCGGACGCCCGAAGAAGGATGGAGACCACACGCGCAAGCCCCGCAAGAAAAAAGACAAGAACGCACCCAAGCGCGCGCTGTCCG
CCTTCatgttcttcagcaacgacatCCGCGagacggtgaagaaggagatgccggagctgcagttcctcgaGATCTCGAGCGAGATCGGACGtcgctggaa
gaagatcacggATGACGAGCGTCGGGTATGTGATGCTGCAACGTAGTGCTTCGCTGTGTGTATTCTGATCGCTAACGGTGTCTTTTTTGTTGCTTTACTG
CAGCCGTACGACGAGCTGGCCGCCGCTGACAAGCGGAGATaccaggaggagaaggaggactACGTCCCGGACCCGTCCTTCGAGTCTACCAAGGGCTCCC
GCAAGAAAAAGGACCCGAACGCCCCCAAGCGCGCGCTGTCCGcctacttcttcttctgcaacgATATCCGCCAGGAGGTGCGCGACGAGAACccgaacaa
gaagatcacggaGATCGCCACGTTGCTGGCCGAGAAGTGGCGTGCACTGCctgagaagaagcgcacCAAGTacaacaagcagcacgaggaggccaagatc
aagtACCAGCGCGAGATGGACATCTACAACTCGCGCGGCACCGtagagcaggaggaagaggagcaggaggaggaggagcacgacgatgacgacgacgacg
aggacgacgaatAAGTTGGCAACTCGCCTGGCCTTGTCTGTCTAAAGGAGAAGGGGACAAGTCGGCGAGCAGCACGGACGTTCAAGCGCCTGCAACTCTT
TCTTTAGCTCGTAGTAGTAGCAGGACCCACGGGGTATCCTCTTTTTATTCTTTCAAGCTTTTGGTAACGTTCGTGCGTTTTTCCATTTCATCGTTCGCGT
ACGTGGCGCTCTCTCGGTAGTCGCGCTTCAACTCGTTGTGCCTTTGCGGTAGCGTCGAGGTCTAGGATACATCCGGCTGCACAGAACGGAACGGAACAGT
TTTGGAGCGCTGTTACGAACAGACACCCGGTTATGCCGTCCTGCTAGCGTCAAGTGCAAGTGCCGACACGAATACAGTACAATGGTTTGTGGATCTTGGT
CTATTGATGTGTGCAAGTAttactgtagctgctgggCTTGAAGGTCAGACCCCCCGTCGGTGGTCTCAATGCAGCAGAACGTCAAAGTCGGGGGTCACCA
CAAGATGGCGCTCCACGTTGCCCAGCATGCTCAAGTGCTTCTCGGCCGTGTTAACGGCATAGATCTCCTCGCAAAAGGATGGTGTCTGGGCCGCCGCCAC
CTCAAATTGCTTGTCGCAAAGCATCAGCACCATCTTGCCGGACTTGTGTACGCAAATCTGTCCACACGAAAGCAATTAGATCTTGCAAGTCTACCGAGCC
AGCTATGGCCTCTATTACCTTGCCAACGAAGCCCCCCGGTGCCGTCTCAATAGAGTGGTCAAACACGCCATCATCCCTGCATACAGAGCATGTCAAACCA
GTTAGATTCACCTCATACTTTCAATTCTGATCATTGCACGCACGGTGACTCTTCCGGGTTTGCCTTCTTGGTATCCTCCTTCGTTCCCTTCGCGCTCTCC
ATGGATTCATCCCCATCAGTACTAGCAGTGGGCCCCTTCGTAATTGCACTCGATAGCGGGAGCGTGGTCGGCATCTGAATGAAAAACAGCGAGTCATCGG
GGGCCACTACGTCCCCGGAGGCATCGCAGAAGACGGCACCGGCGCTCTGAGGCTCAGGCGGTCTCGCAATCGGCAGGCTCATGGGCTCCATTACCGACTT
GACCACTGGCGGCCACACCTCGTCTACCTCCATACCCTCCGGTTGCTTTCCTCCGggcatctcctcgtcgtctaGCACACTGATACCAGTGCCTCCAGCG
GCTGAAAAGTCGGCGGCTGGCGCAGCACGTGGGGCCGGCGCGCTGCCGCCTCCGCTGTAAGAAGAACCACCAGACAATGTGCCGACGAACGCGACCTTGC
CACTGGGCATCACGCCCCGTCctcgaccacgaccacgaccgcctccacgacctcctctgcctcttcctccacgtcctctgTTGTCGCTCTTGAGCGCTCC
AGCACCGGTAGAGTGCGGTTTCGCATCATTGGAGCGCTGCGGGCCTACGGCgcttccttcagcacgtccTTCCGATGCTGGACGGCGCTTCGCAGCCTTT
GGGACGAACTTAGGCCGTCGGGCAGGAGCAGTGGACGCATCGGTGGATGTGCGCAGAGACCTGGGGGTGGAGAGTGTTAGAAGAGGTGGCTAGATGCATT
ATTTACGGATCAACGTACGTGAGGCGCGCGCTGGACGCGGCCACGCGCGGGCGCACGGTGCCATCGCTG