Description :
From Genome Similarity Track
Location :
Scaffold_254:43730- 46346
Sequence
2616 bases(100 bases per row)
ATGAGTTCATATACCAAGCAAAAACACAACGTGCGCGGCGGCAAACGATGACTTGGTCGATGTTATTGCCATGCCGTTCAATTTAGAACTGAGAGCCTGG
GCAACGCGAGAGTCAAGTTGCTCAAGTTGTCGCCTGTCTTTTTGAATGTCTGCAGCCCACTGCTGCAACCAATGCAGTGCCAGCCAAACATCGGAAGAgt
cttcgccttcgtcaccATCTAAAAGCGACAAAAGTGCTGTACAAAGTGCATTGCGTGCCATGCTTGACAGAGTTGCCATGCACGGAGTCTTAATCATCGA
CATTGTGCGTCGTAGCAACTCCACATCGTCCTCGACTATACACAGACGGAACGCGAGTTCGTACTCGCCGCACTGCGCCGCTTCTAATGCAGCCTCAGCA
CGAGAGAGCTCGAGGCTGCTAGCAGTGTTGCTATCGTCCTGTTTGAGAACTGTTCCAACCGCATTGTTGTCCTGGCTTGGTCGGGAGCCTTCGGCCTTGT
TAATTACTTGCGGCGATCGGCGCTTCGGAAGTGATATTTGAGGGATATCTTGGTGTTGAAAGCGTCGTGAACGCGTCTGTGCTCTTTGCTTTGCAGCGAA
CTGTTTTAAAGTTGTGACGGCTTGCGTTATTCCTGTTGCTGACGGAATTGATCGCGCAGGTTTGTCAATTTGCTCTGCAACGGACGACCCCAACGCCACT
CTGTGCACACTGGAGCCTCTGCGCTGCGCTTGGATTCGTTGGTCTTCGCTGCTAGTATCATCTTGTGATGACGGAtgttcagcttcatctccgtcttctg
gtgctgcagcttggtcCATGAACAATTCCGTGAACCTCTCGTCGTCTTGAGTAGGCTCCGCACGCTGCGGTAAAACTTGAGTTGCTGTCTCAATACTTGG
CGTCGTTGCTCGAATTATATGATTACCAGAGCGAGCGCGAACAGGTGTTGCCTGTTTCGTGAATTTGAGTGGCGTCAGGTCATCTTCATCAGTGTTAGCT
TCATGAGATGGCAAAGCTTCGTCGCCTGCTGCAAGGTCGTCAAAAAATCGTGCATCTTCTGTCGACGCGGAAGGCAAGAGTGACGAAATTTCCTTCGCTT
CATTTGCCACGGGGATATGAGAATCATGCGTGTTGCTCAGTACAGGTTTTGTCCATCGTTTGCCAGTAAACGAATAGCCTGGAGGATTGGGCGGGACGAA
ATCATAGCTGGCACTCGCGCTGGAAATGAGTCCGCCAGATGCCTGGGGATACAGCTTCTCCAAGCATTCAAATGCCATGACTGCAGGAATCGCTGCTTCG
CGAACGGGAGAGACCGAATCGCGTCGACCAGCTAGCACAAGAGCTCGCACTCGCTCCTGAAAATGCACAGCAACATCAAATACGTGAGTCTCGAATGCAA
AAATGCCAGTCAATCCGGATACCATACCAAGTGGGATTGAAAGTACTCCTTTGCAGCTCCAACGGAGGTGCACCAAGCAGACTCTTGCAGAACGAATATA
TCGAGGAGCAGTGTCAAGAGCTCCAGGCCACGTTTCCGTAACATCCAGTCGTCACGAGGACCGCACTGGAAGACATCCTCGATCGCCTCGTAGATCGAAG
CGATGTACGGAGCGAGGTCGTCACCAAGCTGTGGGAAAGACCCTTTATCGTGAGCGTCTCGTGCTAGCTGGCATGTCGATTGAAGCAAGAGAAACAAAGG
TGAAAAAGTAGCAAACATCGTGCTACCATCCATCTTGGCAACTGTGTCGACCAGGAGAGTTTTGAAGAACGGACGGATCCGCGTGGCATGAGCGAGAATG
GTGCTTGGACCTGGCACCGACACCCCGTCAAAGTCAACGGGGTGGAGTAGACCACAAAGGCACCTGGTGGCTGCCTCACCCACAGCATTTGCCTCCTTCG
CGAATACGGCAGCCACCGCTTCGAATGGCTGCTGAGTACTGCTATCTCCGTGTTGTCTTCGAGGCGACGTAACTCCAGGGAGCGATACTGTGGGGCACGG
TAGGACGTACAAGGCAATGGATGATGCCAATATCACGCACGCATCCGTTGTCTTGGCGTGTCTGTCACGAAGTCGAAGGCATGCATAGGATAAAATCCGT
GGTAGGAGTTTTGCTACCTGCACCGGATGACATCTGCAGAGAGCTGCGATGAGAAGAACGAGCATGCGCCGCGTAGATGAGCGCCCAGGTTTCTTCAAGA
AACAGTGTTAGCCTTTTTCAAAGACCACCCACGGCATCTATCTGAAGGAACACGTTTTACCTTGTTTTTCTCGATCAACGAATATATCTCCTTCACCATG
GATGGGTTTAGTCCTGGCAAAGATTCACTAAAAGCCATAACCATTAGAAAACTTGTAGCTTCGCGCGGGGGTATGCACCCTAAGTTCTTACATGAGCGTC
GCGAaagcttgctgctgagtaTCTCGGTCTTCCAAGCGGCCGATTAGGACGTTCAGGTTGCATATCTCCTGCGCTTGTCGTTCCTTGGTCTTGCGATcct
gtttcttcttcttgatcgtGCCTTTGGGGCTCAAACTTCCTTTTGCTGATCCAATGCTTCCAAGTTGTCCAGCGTGGGCTGCTGCCCGGCGTTGGAAATT
CGTCTCCATCATCGTT