Description :
From Genome Similarity Track
Location :
Scaffold_142:4373- 9233
Sequence
4860 bases(100 bases per row)
GAGAGAAAAGAAGGGGAGAATCTCCTCCTGTGGATCAGAGAGGTGGAAATGGCCATGAACTCCGCTATGCTCCGGTCGGATCAACAGCGAGTTGAGAAGG
CTATCTTGAAACTAGGTGGTCGAGCCAGAGAATGGGCTCTCACGTGTAGCACGTCGGTAGACGAAGCTTTCCCCACATGGGATTTTTTAAAACAGCAAAT
ATCCTGAGAATTGGCTCCTCCTAATCAGGCATACCGAGTGCATTATCGTTTCTTATCTGCCCGTCAGGGCAAGAAAGAACTATCGGAATATGTCCAGTAA
CTGAGCATTCTAGTCGCTGCCATGCTTTGTCCCTTACCAGAAATGGTTCTTGTTACCATCTTCATGGAGGGCCTTCGCACGGGCGTGGCTCGAACGGAAG
TATTCCGGGTACGCCCACCTCCTTTGAGGCGGCTGTGGATATCGCGTTGGACGCTGAGTTCAACTTTAAGGCAGCCCGTTTTGGCACCCATGGGTAAAAC
CCAAACTTGTCGAACTCTTTTAGCTCATTCAATAGGCTGGAGACTATGACCCTCAGTCTCGCCGAGACGGACGAAGAAGCAGAGCTTCGAGCTATAGAAC
AGCATCTAAATATTCGACATTGTTTCACGTGCGGAAGCACAAAGCATCTGCGACCTAATTGTCCTTTAACCAGGGCACGCCTGGCTACTTCAGGCGGAAC
TCCCGCCGCTAACCAGAAGTATGGTACGGTGCGGGAAAACGTAGACTCTCAGTAGGCGCGGGGCACCCTGCTGGGGAGGAACTAGGTTCTTTTGAGCCTT
TAGGAGGTAGTGGAGAGCGGAATTTAGCCCCAAGGTGTCCCGTGCACTCTAACACGGGGCGTGATTACAAGCCAGTCTTTTTGGTCGCAAACGCGACTAT
TAAGGGATTTGACAAACCCTGGTCGATTTTGATCGACTTTGGGGCATCCTATAATTATGTCAGACGCTATTCCCTTAAAGTGAATCCACGTTATGTTGGG
GCGCTAAACGAGCACGGGAGTGATACGATCACTGTTCGCTTGGCTACAGAAACTCTAGTCACCGCATCTAAAGTCCCTTTGAACTTGGGTGTGAAGTTTT
TCAATTTTGATAGTATCGAACGCTGTTTAGTCCTTGATTTGGAATTGAGATATGATCTCATTTTTGGTATGGCTTGGCTTGAGCGCCATAAGCCATGAGC
CATGTATCGACTCGAGGTCGAAAATATTAGGCGCCACGCGCACTGTCCCTAGCGGAACTATATAGAGTCATGAACCCACCTCTGCTAGGAATCAGAAGCG
TTATTGGTGCGAGCCACTGGCTGACAATGTCAGTGTGCTGGACATAGGAATGTCAGAGCTAGTTGATTCTGAAGATTTCAAAGACATGAGTATAGATCAA
AGCTCGATGTGTGATTGTGAAGTGGCACGTACTCCGCTAAGTGATAGTCGTTGTGAGAGCAACGCACTGAATGCTGAAAGCATTGTTGACCAAGCGTCAA
GTCATCGAGGGTTTATCCCATCAGATGAGCGTGGGGTGGCACGTAAGTACTCACTGAGTGACGTTTGCTGTGATAGCGACGGGTTGAATGCAAATATTGA
CGTTGTTGGTGAAATACCAAGGCATCCCGATCCCGGCTCAGCGGATGCACGTGAAGTGGTACGTAATCCACGTGATGAAGACGTCATGTCCAATAACTCG
TCATCGGATGTCAATAGTGACGTCATCTCTGGCTTAGAGAAAATCACTTTTTGACGATGATATCGATCAGAGAGATACGAATCACACATCGTGTGCTGTG
TCATAAAGTGATGATGACTGTCAGCTGTATACACTTGTCAACGGAGTGATTGGTGCCTATGATGGTACAATTAGCCTTGGGGCTATATCCTCGTTAAGTT
CTCTTTTAGAACTCGAAGTGTCACCGGTCGATGAGTTTGATCACTCACTAAAGAATAGAAACCTTTCAGTGGTGGTGGTCATTCGACCCGACATCATAGA
GTTGAACTCTACTTCACTTTTGGATGAAGCTGTTCTGGGGGACACAAAAGCAGCACTCAGTGCGCGCAGTGGGTCATCAATATTGAAAGACCCTCATGAT
CCCTTTATTCCTTAGTCAAGGAATTTCAAGATGTGGTGTGCCACGACCCACCCTCGGTTCTACCTCCAGACAGAGGTGACCGTCATGAAATTGACTTAGT
TCCTGGGACTAAATACAGTTTCACACGACAGTGGCCCTTGTCTAAGGATTAATGTGATGACATTGATGACTTCTTCCGTGTCAAGCACGAGGCAGGAATG
GTACGTGAGGGTAAATCTCCACATTCGACACCGACATTTTATGTCAAAAAGCCGAACGGCAAGTGGCGTATTGAGCATGCTTATAACAAGCTTAATGCGG
CTACGATTCCGGCACAGTCCCCCATTTATCGAAAGGATGTTCTTCAAAAAAAACCTGGTTGGTTGTACTATGTATAGTGCACTCGACTTGGTCGATGGAT
ATTATCAATAGCTCATGCGAGCGAGTGATATTCTGCTTACAGCAGTGAGCACTACGAGTGGTATGATATGGGAATGGCTGGTGATGCCCCAAGGGCTGTC
TAATGCCCCGGCAGTATTTAATCGTCTGGTGACGCAACTGATCCGCCCACATCGGGATTACGCACAGACGTACTTTGATGACATTTTTGTCCAAAGTCGT
GCCGAACATGGTCGCTCAGATGTTGAAAGCCACATCGATCATTTGCGAGCCGTGCTCGAGTGTGTACGCACTACTAAATTGTACGCCAACGCGTCTAAAT
GCATTTTCGGTGCAGAGGAGGTTCCTTTTCTAGGATTTTCATTGGTAAGCGCGGCCTTATAGCAGATCACGCTAAGGTCAAGGTTATAGTGAACTGGCCG
ATTCCTAAGAATCAAAAAGACTTACGCAAGTGGCTTGGCCTTGCCAATTACTAACACAAATATAGTGAAAATTACGCTGATATGGCTCAACCATTAACTG
ATCTCCTTAAGAAGGACACAGTTTGGCGCTGGGACAACACCCACGCTGACGCATTTCGGGCTATCACGGAGAGTCTCCTCCATGCTCCCATTTTGGCGTT
GCCAAATTCCGAGTACCCTTTTAGTGTTGTCTACAATGCATCCAATTTTGCTATAGGCAGCGCCCTGTTACAAACTAATGCTGCAGGTCGCGAGCGAGTT
ATCGCATTTGAATCTCGTCAGCTGAAAGCTGTTGAAAAGAACTATCCAGTTCATGATAAAGATCTGCTTGCTATGAAGTATGCGCTCGTCAAATTTAGAG
TTCATCTGCTTGGATCCAAGCCATTAGTCGTCTATACGGATCATGCGTCCATTGCGCACAGCGACACAGTCGCCTAACCTCTCTCAGAGAATGGCTCGGT
GGATTTTCTTATTTGCAGAATATAACTTCGAGGTGAAGTATAAGCCAGGACAAAATGTGCTGTCAGATGCTCTCTCTCGCCGACCTTATTATGAGCTTGC
TCATTTCACGACTTTGTCGTCTTCTATTGAGGAGATCATTCGTGTGGCCTATCCACAGGATCCTCAATGTGCAAAATTATTTCACGCCTACCGGAGTGAG
CAATACAAAGACTCGTACAGTCAGTTATCGGCACGCTTGCGGGCCAGCCTACATCGATATTCATTCCATCGATAATCACCTCTTGTGCTATCGCACAGAT
GTAGCGATATCGCTCGCATTGGTGTGCCTCACAATGAGGATATAAAATATTGAATCCTCTTTGAGGCCCACAATACTACCCTCAGTGGGCATTTGCGCCG
GGAAAAGACCTATGGCTATGTGAGTCAACACTACAGGTGTCCCAAACTCTACAAATGGGTGAGCAAATACGTGCGTACATGGGAAACGCGCCAGCGAGTC
AAACTCTCGGCACATTTGAGCTGCGCTACTCGCTAGTTTACCTGTGCCCACAAGGTGCTGGGATTCCATCAGTATGGATTTTGCGTTCGGTCTTCCCAAA
GACTGTGACGGAAAACGGGAATTGTGGTATTTGTTGACCGTTAAAGCAAGTGGCCCACTTAGCGTCATTGTCGGATTCGATCGATGGCAAGGTACATCTA
TGCTGTTTATCGATCGTGTGTTTCGTCAACACGGGTTGCCACTGGCTATCATCTCTGATCGCGACCCTCGCTTTACCGGCAGAATTTGGACTTCCATCTT
CAAGGTGCTTAGTAGCGATTGGACATGTTCACAGCGGATCATCCGCAGACCAGTGGTCAAACTGAGCGAGTTAATTGCGTCATCGGCGATGTTCTTCGCA
GTGTTTGTTCTGAGTCGCCACGGACTTGGATCTCGATGATCCCTGTCATTGAATTTGCGTTGATCAAAGCTGTCCATGCCTCAACTGGCTTTACTACCTT
CCATGTGTATAGCCTCACACACACACACACACCCGCGTTCCGCTCACGTTACCACTACGTGGTTCTGCGCTTGGGGGAGAGTCAGCTGACAAGCTTGCAG
AAATCATCCCTACCACGATGCAGAAACAAGTGAGCGAGGTTCTCGCGACACACTTTAGTGTCCTATTACGCGTTCGTGATGTAATGGTTGATAGCCAGGA
TAAACAAAAAAAGAACAAGCTGATGCTGAAGACAGAGGATGTATTGATTCTTATGAAGTTGTAGAGCAAGTCTTACTTAATGCTAAAAACCTACCTACAA
ATGTAGTGTCTTCCGTTTTCAATACAAAGTTGCGCTCACGCTTCATTGAGCCGTTTATAGATATTGCTAAGCAAGGACTTGCCTATACACTCAATCTTTC
ACGCAAGTTGCGCACCAACCCAGTGTTTTACGTTGGCTAACTTAATCATATCATGATCCT