Description :
From Genome Similarity Track
Location :
Scaffold_1413:4373- 6805
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_1413-snap-gene-0.6MGC11257 protein (Hypothetical protein FP15621).
Pytul_var.sporangiiferummaker-pug3_contig_1413-snap-gene-0.8Lysophosphatidic acid phosphatase type 6 precursor

Sequence
2432 bases(100 bases per row)
CAGAAAATGAAGCAAATGTGGATTCTCCGGTGGATGTACGAGGCCGACGTGGTGCCCAAGTCGATGTTTTCCATTGTGCTCGACTACCTGACCGGCATCG
AAGGGCAAGCGCGGCAGGTTCGTGCATCATTTTGGATTTATAACGGATGAAGAAAAAGTGTTGATTTACTTACGTGTATGGTTTTCATGTGGATTCTTGA
AAACAACAGCGCGTGCTCGATGCTGCGCATGAAATTATTGACGCGGGTGTTCCGGAGAAAACGGGCGAAGAAGAGGAAGAAGATCTGCCGACGCGACTCG
CGCGCCGAAGATACAAGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTCGCCGAGCGCATTTCGTAAATGATCTCCAAGAGGCGATAAAGGTGCATGTTG
TTTATATGCCACGTAACTCATAGCACAATAGATCTTTTTTATCTTGTATCTTGAGAGACTATAAATTTCTGTTAGTGCTCAAAACCTTGGAATTTGTCCA
TGATGAGATGGTAAAACTCCTCGCAAGAGTACAAGGTGGACGCTTCGCTGGAGCCCCCTCCTTGCAAGTTCAAAATCGCGTCGTTGAGGCGAGCACGGAC
GTACCATCGCCCATCGTCATCCTCCAGCAGCTCTAAGGCCACGGCCGACGCATACTCAGGCCACCACTTGTCGTCGTCCGCGAGCGTGGCGTTGATCGCG
TGCAGAACGGACAGGATCGAGATGTCGTGGCCGCTGTAGATGACGAGCTTCTTCATCGCCGGGTCGTTCGTGGTCACTTTTTGGATCTATGCACATTGGA
TAGGAGCAATGTGAGCACGCAAACAACCAGATAGAACGCGTGGACAGAGAGAACGCACCTCCAAAAGCACGTGCTGCATCAATCTTCCAGCGACGAGCTG
CAAAATCCGTGGATGCGAGTAAAACTGTGCACATAATATCCCCGCCCCCATACGCACCAGTAAGTTGACTTCAATCTCCCTTCCTGTATGTACACAAAGA
GAGAGGACAAACGACGAGTTGTTCTGCTCGTGTCATACCTGATGGAAGCGGAAACTCAGGTGGAGCACGGAGGCGTCACAATGGGCCTCGGTGCCTGGGA
TCATTGGGACGCCATGCGCATCGCGGCACACAAAATAATCCGCGGCCGCCATCCACGTGAACGGCTGGCTGCCAGACGCAAACATCGGCAGCGCGCGCAT
CAGCTCGGCTTTTCGCGGCGCCATCTCGTGTTCGCGGAACGCAAACTCTTCGTTCTCGTGCTCCAGCGCAGCCTTCAGCGTCGCGATCTCAGGGAACGCA
GCATATGCTATCATATGTACCCACGACAGCAAGTTGCACCACTTGAGATCACAGTCTTACGCATATAGCAGCGGTGCAACACTTAACTGTTAATCATGTC
GCGATCGGGTGGAAGCACATGCACGCGCGGCGTGATGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCGCCTGGACG
CTCAGTTGCGTGCGCGTGTACGAGTTGCTGAAAATGTGCACGTCTCGATCCGTCAGCGAGTCCATGGAGAGCGCTTCGTCGACGCAGAAAGAGCGCTGCG
AATGTCCGGAGTCACATACACAAACATACATGATGAGATGAGACAAATACCCATATATACTACGAGCTCTTCCATGCAAACGGTCATACCACTTTGTCGC
CTCGTGCCGTCATCTGCTCAATGCCCGTAGTCGTGAGGTATCCAAATGGCCGAGTCTGGTATGACTTGGCGCTTCCGNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACGTCGTCGGCGGACGGCAGCTTCGGGGCCCAGCGCTTGCACTCTTCAAGCTCC
GCGAGTGGGTCGCCCTTGAACACGTTGCGCAGCGGCGTGCGGTCCCCATGACGATGCAGCACCTGCAATTGACGCAGCCGCAGGGTCGCCCCTGTCGCCA
TGCTAGAAGATTGCGCAGTGTGTCTTGGTTGTGGGCGATTGTGGCGGGCCGGGTTTGGGGAACATTCTCAGACNNNNNNNNNNNNNNNNNNNNGCGGCAC
GAGGCACACGCGCAAGCTGACTGCAGAGTGCTGTTGTATGCATCCATCACGCGCGTCAATCGGACTCGCTTTCCTATAGGCACAAGGCGCGGACATGCGA
TCGCTCTCCGTTCGCATCATTAATTCGATACAAGGCGCAAAATAGCTCCGCATTGGGTTGGCGCGCCGTTTCGAAACCACTTCAACCGATGGTTGCAAAC
TCACCAAATTCAAAGGGGTATCTATTCTAGCAGTTGATAGTTGATATTATCTCAGTGTACACTGGTGCACTTCGACCAAGACATGCATTTGTAGAGGTTT
CCAGCTTGAAGTGGCCGCTAAATGTGGATACG