Description :
From Genome Similarity Track
Location :
Scaffold_19:4373- 5605
Sequence
1232 bases(100 bases per row)
GGCGAGGGGACCGGAGGCGCAACGAGATGAGTAAACTGGTAGGTCCACGAGGAGATCCCAGAATACACCCAGCTTCCGATAAACCAATACAATACAGAGT
TATACACAACAAACAGCCGCCACTTATTCTTTGACCCTTGGGCGGTGGGTCTTACGCCAGTCGACTAGGCCGATTCCAGAGTACTGGTCAACTCTGGGGC
CTCTCGTAACGCGCACCACCCTCTAACGAGGGAAATATACACAATCCAATACAATCCTCTCTCACGAATGCAGTCTCAAAGTCAAACACTCAGGGGACAA
CCGCTAATAAATCTCCCCAAGCTCAATCAGTAACATGAAATGGGACACCACCCTTACCTACACGCAATGGGCCCAACTAGGATATGGAATGCGTGGATCA
CTTCAGACGCTCGAGTAAAAGATCCCCACGCAGATGGACTTGATGATGGTGGGGAGCTCCGCGACGACCGTGTCATTGGCGACCTACGGACCCGATTCCT
GGCTGGCAGTGACTCTCGACTTGCGCAGTAGGGGGTAAAACGAACTCTCTGATTGTTATCTGCTAGATTATCGCTAAGCTCAATATAAAGGCTATTTTCT
TCTGGGTTCTTCTGGGTTCTTCCGTGTTCCTTGCGTGCGATCTTCGTGAATATCTTGACTTGAGTATGCTTGGGGGGGGGTTGTATACGCCGACCTCGAA
GTAGACTGGATTTTTCATCCCACTCTTCAGTCAGTGACTTCTGGGTACAAATCAGGTCAGTCATCGTCGCTTGGTTTCAGGCTTGAATCCGAGGGTGCGT
TTCAGGGATCCTTGATTCTGCAGCACTTGGGTTCCGGCATCCGGTTCCAGGGGACCAGCGGGCGCGACTTGTGTTGCGAGGCTTTGAGCTTGTTCCGGGT
GCGCGAGGTAGTTTGTGGGTCTCTATCGAAGCGAGGCGGGACGCCAGCTGCAATACGTTCGCAGGGGCGTTTTAGGCATCCCGAGGGTCAACCCGCTTGA
GGACGGGGGCGACTTAGACGTAACACTCGATTCCAGGGATTCTCGTCCTGAAACGCGAGCTTCCAAGTCTGAAGGGCCCATCTTCGATCTCACCACACTC
GTTCCGCGGAACACCGCCGAAGTCTGGCGAACACCATGTCACACGGGTGCAGCCGGGGCTGAATCCATCAACCAGCCAATCAGAGTGCAGATTTCTGCCA
CGTCAAGCGACTCACTCCGGCCTCTCGGAAAA