Description :
From Genome Similarity Track
Location :
Scaffold_573:4372- 6203
Transcript NameFunction/comments
Phyke_g10405hypothetical protein PHYSODRAFT_534001

Sequence
1831 bases(100 bases per row)
TCATTTACGAAATCGCCTTCACCCGCACATATGGCCAAACAATCGGTGCCCTCCCCGGCACTTACGCCACAGTTGACACCCTCCGTCACCGGCTACGTGA
ACACCAAGCTTTGGGACGAGCGCGCCCCCAAATATACTCAACATGTGCTTACGAAAGTCtgcctcttcatcctcatctgCACGGCGTGTGAGGAAGTGAC
GAGCTTTGCCGTCGGCCAGTCgctcaagaacttcttcaccaaACTGGGCTGGTCCAACAAGGGCTCCACCTCCATGAAACTCACGTTCGACTCGTTCAGT
CAGTTTATGTGCATCGTGGCGGGGTACATTTCCGACGAGCGTCTGGGCAAATTCAAGACGCTTCTGTCCGCCGCCACACTCGACTCGGTcggtctcctcc
tccttgtcgtTGCAGCCTTGCCTTCTGTCTTGAACCACATCACCGTGAGCAAGACCATCTTCAACATCGGGCTGTTCTTGGGTGTCGCTGTCTCTCAGAT
CTGCCTTCGCTCACTCGCCATCTCGTACGGTGGTGACCAGTACTCGCCCTCTTCCCCTCCTTCACACAAGgcactcttcttcagcatccagTACTGGGTC
GCCAACATCGGTGCCTTCATCGGCTACGCCGTGTTCCCATCCGTGTCCATTCACGGGTTTGGCGCCATCCCCGCCGACTACGGCTACGTCAGTGTCTACC
TTGTGGGTTTCGTCATGTTGCTGATTTTCGTGGCGGTACTCTGGTTCTCTCGCAAACGCTACGTGAACGTGCCTCCGACAAAAGAATCCATCGCCCTCGT
GATCAAGATCGTCATTAACcacgccaagaagaacttcCACGCGCAGATGGTCGTGCTCGGCACGGTCCTGTATATCAGCGCCTTCCTGCTGAACATCCTA
GCCTCCGTCTTGGCGGACCACGGCGAGGTAGGCCACAACATCTCGTACGCATGTGGAGTGATCATTGCGATCGCGACGACCCTCTGGGTCTACTTCGGTC
GCAACTCGTCTTTCATGGAGGGTGCGAAGGACACACTTGGCGGCAAGTTCGACCCTGAGCTCGTGGACGGTGTGAAGCAAGTCATCCGGATCCTCCCGTT
CAATGCCTTCAACGTGTTCTGGTGGGTGTGCCAAAACCAGCGCGGCAACAACCAATCCATCGTACAGCAGACAGACACGCGTCTCGGCAGTGATCCGTTC
TCGCAGCAAATGCCTGGCCCCACGGTGCAAATGTTCAATCCTATCGGTGTGCTGATTTTCGTCCCCCTCATGGAGAAAGTCGCCTACCCTCTCTACGAGA
AGTACGCGGGCAAACCTGCGAGCCGATACGGCAAGGTACTTGTGGGTTATTGTATAGCCGTAGTCGCCATGTTTTGGACTGGTGTTTACGAAATTATCCG
CCGTAGTACCTCTGTGCTCACGTACGTAGACTCGAACGGCGTCGCACAATTCATGCTGAACGACGACGGCGGCCAGGTGATGAACGATATTCCATGGTGG
ACAGCCATCCCGCAGTACTTCCTCGTGGCGCTTGCCGGTGTGATGATTGCCATCCCGTCGTACGACATCAACTACTCGGAGGTTCCGCAGTCCATGCGCA
GCACGTCCATCGCGCTTGGGTTCTTCGTCAACTCCATGGGCAGTACGctgctctccatcatcgTACTGCTCTTCGGCAAGTACATCCCCACGGACCTGAA
CGACGGTCACATCGAGTACCTGTTCTTCACGCTGGGAGCGATCATGATcgtcaacatcttcttctACGTAGTGGTGATGAACAGCATGCAGCTCGGTATG
ATCCCTCGTGTAAACAAAGGCGACGACAAAG