Description :
From Genome Similarity Track
Location :
Scaffold_99:43713- 51444
Transcript NameFunction/comments
Sappa_CBS223.65SPRG_21155Hypothetical protein
Sappa_CBS223.65SPRG_12500protein recA
Sappa_CBS223.65SPRG_12501arabinogalactan protein
Sappa_CBS223.65SPRG_12502unnamed protein product

Sequence
7731 bases(100 bases per row)
CTAGGCGACAGCGTCCTTGACAACGTCGCGTTCGCCCGTGCGTACAATTCGGAGCACCAGATGCAACTCCTTTCGCAAGCATCCGCGATGATGGCAGAAT
CGCGATACGCGCTCGTGGTCGTTGATAGTGCCACTGCACTCTTCCGCACCGACTATTCGGGACGGGGCGAGCTGGCTGCTCGTCAGCAAGAATTGGCCAA
GTACTTGGACGTATTTTTATCGACCAGGCGCATTGACTTTTTGTAGGTTTCTTCGAGCCCTCACACGTATGGCAGACGAGTTTGGTGTCGCAGTCGTCAT
CACCAACCAGGTACACGACACACAGTGGTGGCCCGGCGCAGTCACTCACACGTCGTAGATGACAGCGAACCCGGACTCGGGCATGTTTTCGAAGGATCCG
CTGCAGCCGATTGGCGGCAACATCATGGCGCACGCCTCGTGCACGCGGTAGAATATCGTCCGTCGCGAGCGCGCCGTCCCTCAAATCCAACGACGTAGGC
TGCGTCTCAAGAAGGCTCGTGGCGAAAACCGGGTCATGAAGGTGATCGACTCGCCGATCCTCCCCGAGGCCGAAGCCATGTACTCGATCACGGAACAAGG
GATCCAGGACGAGCAAAACTAAGTAACAAATATCTAAGACACCGCCATCTGTATGATCTAGTCTTAAGCGGTTGACCAGCGCACTCATTATCGGGTTGTC
GTGGTGGTGTCCTCCTCGATGTGCACGGTTTTCTCCATGTCGTGTACCTCGGCCATAATGGCGTGGATGTCAACCCCATCGACGTCGATACCAGGCGTTG
GTTCCACAGGCACTGGCGAAGGCTCTGGTGGGGCGTCGCGCGTCAAGAGCGCAGCGCGAATCTGAGCCTCGATCGTCCGCGCAATGTCTGGGTGCGCCTC
AAGGAACTGCTTGGCCTACGTCATGAAAGCGGTTGAGTCAAAACCGACTGCGCCACGTCAAAAAACCTTGCTGCGTCCTTGCCCAATTGGCTCTAGTCAT
ACAGGAGATGGAACCTTCATAGCGCGCAGTTATTGAGTACCGTCGTTGTAGGCATACCACGAGCCGGACCGCTTCATGGCGCCAACCTGCGTGCCGAGGT
CGAGCTAAAAGCATCCGTCTTGGTGTGTAGTATCTGATGAATGAGAAACGTACGATCTCGGACATGCGGTCGATGCCTTTGCCGTAAATTACGTCAAAGT
TGGCGACTTTAAAGGGCGGCGCGAGCTTGTTCTTGGCCACCTTGACGACGGTCTCATTGCCAATGATCTGGTGTGCCAACATTGATGACTGCAGAGAAAG
GAGAGCACAACATACGTTTTCGCCTTCCTTGATTTGGGTCTTGCGGCGAATATCGAGACGAACTACGGCCCGGTGAGCTCGAGCTCGACGCAGTCTAGCA
TAGAGTACTCGATGCATAGTAGCGCAACGCCGTGCCGCCGGACGTGACTTCAGGGGACCCAAAAATGATACCAACCTAAGAGAGAGCTACGTAAAGGTTG
CGATTAAAGAAATTGTTGCAACCTTTTGGCGGATCTGGTTGAGGAATATGATCATGCAGTTCGACTTGGAGAGAGACCCTGTGAGCTTGCGCAGCGCCTG
CACGTGCCAATGGAGCACAGAACTCACTGTTGGAACACGTCCTACCTGGCTCATGAGACGTGCCTGCAGCGCGATCTGCTGGTCGCCCATTTCGCCCTCG
AGCTCGGCGCGCGGCACGAGCGCAGCGACACTGTCAACGACAACCACGTCGATGGCTCCGGACCGAATCAACGTGTCGGCAATTTCGAGCGCTTGTTCGC
CAGAGTCGGGCTGCGACACATAAAGCTCGTCAATGTTGACGCCTAATCAAGGGGTGTGCGCTAATTGTTTCGTCATTTTACGTACCTAGAGCCTTGGCAT
AGTGGCCGTCGATTGCATGCTCGGCGTCAATGAACGCGCAAGTTCCACCCTAAACAATCAATGCACCGTTCAGACTCACGTACAGCGGATTGAGCGTCGT
CCTACGTTCTTTTGGGCTTCGGCGATGCAGTGGAGGGCAAGCGTCGTCTTGCCCGAACTCTCCGGACCATACACCTCAATCACCCGCCTATTTCATACAG
TAGTGAGCTTCCTTATGGTTATAGCGTCGATGATGAGAGACCCGCGCGGCAGACCGCCGATGCCAAGTGCTACGTCCAACGAGAGCGAACCCGTTGATAC
GACGTCTATGTCGTGGGCGACGCCACTAGCCAAGGTTCGGCATAGAGCTAACGAGACCACGAGGCTGCACGTACCTAGCGCCGAGTTGCATCACAGCGCC
CTTGCCAAAGCTGCTCTCGATCTGGCGAATGGCCATCTGCAACGCTTGGCCCTTGTCGCCTGCAGAAGCTGCAGTGAGCGCCTAAGGTTGACCTCCATGT
ATGCGTGTACCAGAGGCGCTCGGCGAAGCCTTTGTCTTCTTGTAGCGAACGAGCGCGCGGGCCACGATGGCAGGCGCGCGAGAAAGCGACAGCATCTCGT
TCCTTCCCGAAGCCTGAAGCACTTGGTTGTGATCGAGTTTGGATACATTCGTACGCTATTTCACGCCTCTGGTCACACTATACATGATTAAACGCCCAGA
GCTCTCGTCGGCGCCTTGCAAAAAGCTCCAATAGAGCCTTGCTTGAAGTGTTTCGTACGAAACAAAGCAATCGTGTAGTGCTATCAAGGGCATACATGAA
GACAACGCACGATATGATGATTTGATGTTTACAGCGCGCTCCCGGTTCGGAAGGCATGCGCTCACAGTATCTTGTGTCACACTATATTCTTCTAGCGCAA
ATGTAAATGTAAATACCAGACGAGAGAGAGGTAATACTGTATATCATGTATTGTATATCATAGGTAATGTGTTTTAAAAGGATCAATTTGGCGCCAAAGT
CGCCATCGTTCAAGTGAGCGGGAACACTCCATGACGGCAGCTCTTGGTGGTCAAACAACGTATCGATCTACAATTATCCAATTGATATTATGCGGACGCA
GTACGTAGACTGTGAGGGCACGTACTGATCGTAGTGACGTTATGGGGTCGGTCCTCGCTACTAACAGGTCCCGTGCGGGGTGAGCTGGTAGGAACTTTTG
AATGCGAAGCGTTGTTAACCGGTATTTGCGACGACGGCGCGTCGCTTGCTGCAGTCCTCGCGCGCTTTCACATTCGCACCTAATCGGAAAGTTGCGTGAA
TTTCAGTCAAGTGCGCCGTCGTACTTAATCGAAATTGTTATACTTTAATCAAGTATAACGTCCGGCGATGTGACAGCACTTAACAGGAATTTCCAATTCG
CACTTAAAAGGACACATTTGGCGCGATATGATTGGCTTAGACCAATGAAACTGCGTTTCATTGGTCAAAATGGCCGTATATATAGCCAATGGGTTGGCCG
GATTGAGACACGACACGCCGAATTAATCCCCTGGGATGCTGGTACACCACGTAAACGTTCCTACCAGGATTAATAAGAGGCTTAACGCTATTACTTCACG
CTACGTATTACTATGGAGGAGAAACCAAGAGTTGTTTACAATCTTCGCGCATGCTTCCAGAGTTGTCGAAGCAATATGTTTGCTACTATAGCGCGCAATT
CGTAAAAAAAGAGTAGACGCAGCACCTGGTTGTACAAATGTACCGGTACGTCGATTTCATCGCGGCAGCGTTCTCAACAACGCACCACGGCCCAGACCAC
CGCCATTCGATGAAAGGCACCGCGAGCCACACCGTACGTTATCACCAGCGTTATCACCATGAGCGCGAGTCTACGGTGTGATTTGAAGTCTATACAATTT
GTACAGACGTTTCTTGGAGGAACACGTGTGGCGGCAACCTACCAGTAGAATAGCGTCAACTGGTTGGCTATAAATGCGACCAATCGCAGAGCAAGGCAGG
CAATCCAATCCGACACGATGAGCCCACGTCGTCATTGTCAGCTTTGTGCAGTGTTTCTAAAAATCCAAGTGGATTGATTGGCTAAATCCAGCCACTTATA
ATAATTACTAAGCTAGATAGACAGAGCATAAATTATTGAATCCAACTCCTGGAAATCTCTCTGGAGGCCAAGAGACGACCCTGGACCCAAGCGACCGCCA
CTGCCTCGCACCAAACTGTACATTAATTTCGAGCAGAAGGCTCTTCAACACCCACGCAAAGTCGAAGTCTCGCAAATTGCAATTCCTGCTCCGTGGAACT
GCATCGCTGGGCCGAGACTTCGACGAGGTGTGCGTTGTGCCTGAGCGCGAAACCTTCGGCAGGCCTAAATTTACTCGACTTCATCGCACATACCATGTCC
TTTGCGCCCACGCTCTTCAGTGACAATGGCAAGGCACTGCCCCTAGCCAACACGGACGAAGTGTTCATTCTGGAGCGACCGTCGATCGCGTTCCAGTGCC
TTGTCGACGGGTGCGTACGATCCCCAGTACACGCGCAGTGGCGATGCCGGGAGTAGACATAAGTTCAAGGCCTCCGGTCGCATCTACATAACGACTCAGC
GACTCGTGTTTTGCGCCGACAAGGCCGCAACGCAGCACGGTCGGTTCTTTCAAGCCTTTGTGAGCGCGTTAGCTGGTGGTGCTATGTGTGCCTGAACACG
AACGTAGGAAATCCCACTGGATAACATTGCGGACGACAAGTTCAACCAGCCAATGTTTGGCTCGTGCAACATTTCTGGCGACGTCTTCCCGGTAACACGA
CACCATACAGCGTTGAGACGCCAAGGCAACTAGGTGGGCACGGACGAAGGGGACGTGGCGACGCCGATCGAGTGGCGTGTTTCGTTCCCGAACGGTGGCA
CAGGCACGTTCTTGCCCATCTTTCTTCGCCTCATGGAGCACAAGAAGCATGGTACATCGTTCGTACTTGCACCGTGATCGATGTCCAAGCGCATGTTCTA
GCGGGGCTTGTCGACGAGGCGTTTGCAGAGAAGCAGCGCAAGGCGTATGTGGACCCGAACGACCCAACGGTCATCTATGTTTCGCAGCCCGTACGCCCGC
GTGGTAAAGACACTGTCTGAAATCGAAGACAAAGACAAGCATATTTCTGGCGCAACTACCACCTACCTTCGATATCTTGCCCCAAACGACTGGGCGTCCA
CGCTCATTGCTATGCTATGCGCTATACGGGCACCTTTAGTAGAATACTGGATGGCAGCATGGTTCATATGCAACCACACTATAGCGGCATTGGTATCGCT
CAACCTTCACGACGCCGTCAAGTCCTCCTGTTGGCGGTAGAGGTGCTGCGACACGGCGCTGCCACGTCACAGCGTGGCTTTGGGGATGTGTCAGTGCCAT
GCGAATTTTTCATTGGTCGATCGTTGTGTGTATACTAGACCCGACTTTCGAAGTTGCCGTTAGTTTATCTTTTGCACGGACGCCGCCACATCGCCTCGCA
TGATCCTCCCGCGCTACTCTGTCTTGATCCCGACGCTCGTAGTCCTCAGCTACGGCGTGTACCAAGCCTGCCTTGAGCCTGCCCTCGGTGACGAGTGCGC
CACGGACGACGACACCGACGAAGCGGCCATTGACATTCTGCCGCGTATCGTCGTCAAGGTGGCGCACACGGGCAAGTCGAGCCTCCGAAAGGCACGGAAA
GCGAGACCCACCAAGCGCGTCCACTTCCAACTGCCTCTTGCTTGCGATACCCACCAAGACGACCACCGCCATCTCAGCAGCTGCAAAGACATGGTGCTTG
CGCCGACCACGCGGCCCCGGCGACACAGCACCGGTGCAATGACCGCCGGACCACTCGTCGTGTAGGCTCGCTAGCCCATCTTAACATTAGTGCTATTTAT
TATGATCCATCCTTCCCTGGACATTTACCGCACCACAGCGCTAAGAACAGAGGCGCCCAGGCCAATGGCGGAAACCTGGTCATCGAACGCGACGGATCAG
TTGAAGTTTGGGGACGGGTACCAGGGGACGCCCATCTGGTCCGACCACGTGCGCTCTGTCGTCATCGACGATTGGGAGGAAGAAGCCAATGGCAAAGGTT
CAATACGTCGACGCAGTACGAACTTGCCCCTTCCAGCGTTGGCTCCCAAGGGGGATGCTTTGGTGTCCACCATCGACGACCACCCGTCGGACAAAGTCGT
TGGAGGCGATCGTTAACGGACATGCGAGGAGCCCACGACGCGTTACATCTCCTTGAAGCTGCGTCGGCGAGATTCGAGGTTCGTCATCCGCAACACGAGG
TTCGTGATGGAGCATGACCTCGCGCACCTGACCGCCGCCAGGATACTCCAGGTATTCTTGTTGGATGGCCATATCTTTTGCTCCAGAGCGTGTTGGTTTA
GTCCGCTCTGGGCTCGTGCCGAGGGGACAGCCTCGGTACGCTGCGGATCAGCGGCGGCTCGTCGCACGCTTACCACCGTCGTGTGCGTTGCGACGTATGC
CCATCGCTCGTTGAACGTTCACGCAGTGGTGGCGCCCCGCGCCCCGTGACCGCTGCTGTTGTGCGATTGGTTGGAATTTATTTATTTTCCAACGAAAAAG
AAACATGCAAAGATTTGGAAGCCTGAGGCATGCACAGCGAGAACCAGACCTTGTCGCCGCGCCATCGGCTCACGCTCCGCGGGGGCTGGGAGCACCGGCC
GCGCAGCGTGTCGTCGCAGCTGCATGAGAACCAAACCAACGGCGACAAGCCGGTGCGTGCCGTTGGCAGCGCAGCCTCGTCCTCATCCACGCTCACTGTG
TAGGTCTACAAGGTTGGCATCTCGCTGGCGCAGATCCTCGACCGCAGCTACACGCTCGGACGCTTTCGCCAAACCAAGATTATATGCGCTATCGGCCCGA
GCTGCTGGTCCACGGAGATGCTCGGGCGACTGCTCGACGCTGGCATGAACGTCGCACGCTTCAACTTCTCCCATGGCGACCATGCACTGCATGCACGGTC
GCTGTCCAATCTTCGCGACGCGATGCAGACGCGCCCCGGGTGCCACTGTGCCGTGCTCCTCGATACCAAAGGCCCTGAGATCCGAACAGGTAATCGCCGG
AAATCCTGTCTCGGAATCAACATCTATTCTGTAGGACCCTTGAAGGACCACATACCCGTGCATCTCGTCTCGGGCCAGGAGCTCGTGCTCGTGGCCGACG
AGTCTTTTCAGGACGGCGACGCGACGCGCATCGGATGCAATTACGCGCATCTCGCGACGTCCGTGTCACCGGGGTCCACGATCCTCGTCGACGACGGTGG
GCTCACGCTCAAAGTGCTGGCCTGCAAAAGCGCTACCGAAGTCGTGACGCAAGTCCAAAACAACTACGTGCTCGACGAGCGCAAAAATATGAACCTGCCC
GGTACCTCTTGACGCGCAACGTGTTGTCTCACGACAACGTAGGGGCTGCGCTGCGTATCCCTGGCATCACGACCAAGGACGAGCACGATCTACGCGAATT
TGCCATCCCACAGCGCGTTGACATTGTCTCTGGTTCGTTTGTCCGGTCTGCTGCCAACGTCCGGTATGCGCATTTCGGTTTGAAGACCACTGAGTCGTCC
ATAGTGCGATCCGGGCCTGCCTTGGGGAAGCTGGCAAGTACATCCGTGTGCACGCCAAGATCGAGAGCCTCGAGGCGCTACGTAACATTGATGAAATCAT
CGCGGAAGCCGATGGCGTCCACGTCTCCCGCGGCGACCTCGGCATGGAGCTGGCCCCAGAGCAGGTGTTTATGGCGCAAAAACTCATCATTCGCAAAGCC
AACCTCGCCAACAAGCCTGTCGTGACGTCCA