Description :
From Genome Similarity Track
Location :
contig_11:437075- 439420
Transcript NameFunction/comments
g2622.t1hypothetical protein L917_03096
g2623.t1hypothetical protein

Sequence
2345 bases(100 bases per row)
CTCCAGCTGCATGCGACGCAACGCCGCCTGGGTGCCCTCAATCAAGTGTTTGCGGCTCAATCCCTGGCTGTTGGGCGTGCCGTTGGTGAAGCCCTTGGTC
CCACTGAAGATTTTCGCAGTGACCACGAGGTCTTCACGACTCCATACGCCCTCCTCAATGCCCTTCTTGATAGCACCACCCAAAAGCGCGTCAGCTTGGC
CCAGCGCGTAGTTCTCAGCAGAGTCAAAGAAGTTGACCCCATGCTCGAAGGCAGTCTTCATCATGTGGTACCAGGCGTCGACGGTGTGGGTCTGGTCAGG
GTACATCCAGGAGCCGAGAGCGAGCTTGGACACGAGGAGGCCCGAGTCGCCGAGGAAACGGTAGGTCATCTTGGCAGGAGCAGTCATTGTCGACAATAGA
GCTTAGTGTGTGGAATACTTGCCACGTAGGAAGCGAATTGCAAAGTACTTTACTCGACGAGTGAGATTGGAAGTGCACCACCTTTTGGGAAATAGTGGCG
GGCGAGCCGCATAATCCCGGCGACATTTCGGTCACGGTAGCACCTCGCTATCTGTATTACGATCCTCCATTTCATCAGAATGACGCGAATGCATTGTCAT
ATACAATGAATGACCCCGCTCATCTGTTCAGGAAGGTTTCTCTGTGGTCCATGGGCTCTGTTGAATGATTCACGATCTTACCTAGTTGGGCCGTCGACAT
GCATGTATCTGGTTGACTCGGCTCAGAGAGCTTAGCTCTTCATTGGCTTGATTATGAAGTGGTTTGAATGCATCGACCTGTCGGCTGCTGCAATATGAAG
TAATACCGCAAATGCATAATCCTCCAGCAACTCGAAACTTCACCTCACTATCCTGTCGGTTGATGTAGTCTGGTGAAATGGCGCCCAATACATAATCTCC
ATCGCAGTACACTGTAGAAACGCTCAAGCTCTGGCAACTCGATGCTCCGCCTCATTCTTGAAATTGCTTCAGAGTGAGCACAAGTTACCAAATGCCCCAA
GCTACCCCTTCGCCTTCACGATGGCCCCTGCGATTGGTTCCCCGCCAAGATGACCTACCGCTTCCTTGTAACTCCGGTCTGCTGGTGTCCAAGCTTGCTG
TCGGAAGCTGGATGCACCGTGAAGAGTATCAGACGGTGGACGCCTGGTATGAAATGATGAAGACTGCCTTCAAGCACGGAGTCAACTTCTTCGACAACGC
CGAGATCTATGGCAACGGCCAGGCGGAAGAGATTATGGGCGGTGCCATCAAGAAAGGCCTCGAGGAAGGTGTGTGGAGCCGCGAGGACCTCGTGGTCACC
ACCAAGTTTTTCGTCGGATACAAGGGCTTCACCGAGTCTGGCCCGAACGACCAGGGCTTGAGCCGCAAACACATCGTGGAAGGTGCTCGCGCCTCACTGC
GCCGCCTGCAACTGGAGTATGTGGACGTCATCTTCTGCCACCGCCCGGAGCCGTACACCCCGATCGAGGAGACTGTCCGCGCCATGAACTACGTCATTGA
ACAAGGCTGGGCCTTCTACTGGGGAACCAGCGAGTGGCTGGCGTCGGACATCCAGGAAGCCTGTGAGATCGCAGACCGCCTTGGACTCATCCGCCCCATT
GTGGAGCAGCCGCAGTACAACATCTTCACTCGCAGCAAGGTGGAGTACGAGTACGTGGACCTCTACAAGAAGTACAAGCTGGGTCTCACGACTTGGTCAC
CGTTGGCGTTCGGCACGCTGACGGGCAAGTATAGTGCCGGAAGACCGGACGGTTCGCGCCTCACGAAGCCTGCGTTTACTAAACGTGAGCTGGTGCCTAC
CTACGACGAGCGCGTGGAGATTGCCGACCAGCTCAAGCCGATTGCTGCTGAGATCGGCTGCTCGCTGCCCCAGCTTGCTACTGCCTGGTGTGCAGCCAAC
GAGCATGTGTCAACGGTACTTGTTGGAGCGAGTCGTCCGGAGCAGTTGGAAGAGAACCTGAAGGCGATTGAGTTCGTGGACAAGATCACGCCGGAGGTGA
AGGCCAAGATCGATGCGATCTACACTGTTACTCCGACTGTGCCTGAAATGAACCCCTCGCTTTCCTGCGCAAGCGCCACCTGTAAGCTTTTCACTGAGCT
GGAAAGCATTGTAGTGCTGCAAGGAATTGTAGTGTGAGCGAAAAGGAATGACGAAACGATAACGAAATCGATGAATTTGTTTGTTGGCGCTGTTTGCTCT
CTCTACGCAGGCGCGGTCTACTCACGTAGATGATAAAGAGGAATCTGACGCTAGTCAGCACCCAACCTCCCCGTCTTATTAGAAACGAACCCGAGGTGAG
CGAATGGATCAAATTGGTAAGCTCATGAAGTTCTCATGAAGTTCT