Description :
From Genome Similarity Track
Location :
contig_91:43702- 45848
Transcript NameFunction/comments
g10626.t1hypothetical protein

Sequence
2146 bases(100 bases per row)
GTCCGCTAACCCGTTCTGCCTGCCAGGCTTGTACTTCACCTCGAAGTTGTACTCCGCAAAGAAGGAGAGCCAGCGGGCCATCCTCTGCGAGAGGTGAGGC
GACTGAGTCGCAGTGCGTAGTGACGCATGATCAGTAAAGATGACAAATGGCTTAGAGCCTAGCAGGTGAACCCTGAATTTGACTAGAGCATACTTCATTG
CAAGTAGCTCCTTGTCATGAACTGGATAGTTCTTCTCTGCAGCTTTAAGCTGGCGAGACTCAAACGCAATTACGCGTTCACGCCCTTCGGTGTCTGCTTG
CAGCAGTGCACAACCGATGGCAAAGTCCGATGCGTCACAGACGACACTAAACGGACGATCGGGGTCTGGCAACGCCAGGATCGGCGCGTGTAGGAGACTC
TCCTTAACCGCCTCGAGGGCAACTTGATGCTCGGTGTCCCAGGCCCACTCCACATCCTTCTTAAGGAGATTGGACAATGGCCGAGCCATATCAGCGTAGT
TCTCGCTGTACTTATGCAAATAGTTGGCGAGGCCAAGCCACTTGCGTAAGTCTTTTTGGTTCTTGGGAACCGGCCAGTCAACAATGGCTTTGACCTTAGA
GGGATCCGCTCGAAGGCCGCGCTTCCCGATGAAGCACCCTAAGAAGGGGATCTCTTCAGCACCGAAGATGCATTTGGATGCGTTAGCGTACAGCTTATTA
GTGCGCATGCACTCGAGCACCGCTCGCAAATGGTCTATGTGGTTGTCCACATCTGACTTCCCGTGCTCGGCACGACTGTGGACGAAAATGTCGTCGAAGT
ATGTCTGTGCATACGCCCGATGGGGCCGGAAGAGCTGCGTCACTAGACGATTGAACGTCGCGGGCGCATTCGACAGCCCCTGGGGCATCACCAACCACTC
CCAGAGCATCCCGCTCGGGGTGCTGACCGCTGTCAGCGGAATGTCGCTCGCACGCATGAGCAACTGGTAATAACCATCGACTAAGTCGAGCGCACTGTAT
GCTGTGCATCCAACCATGTTGTTCTGGAGAACATCCTTCCTAGGAATAGGCGTCTGCGCCGGAATGGTGGCGGCATTGAGCTTATTGAAAGCGTGGACAA
TGCGCCACTTGCCGTTTGACTTTCTGACACAGAATGTCGGCGTCGAGTGCGGAGACTTGCTCTCGCGCACCATGCCCGCCTCGTGTTTCGCACGGAAGAA
CGCGTCAATGACGTCACACTGCTCCCTTGGCAAGGGCCACTGCCTTGTTACGCAGTATTTGGTTCCAGGGACCAGGTCAATCTCATGACGCACGCCTCGA
TCTGGAGGTAGGCCAGAAGGCGGATCGTTGGAAACGACATCTTGGTATTCCTTAACCAAGGGATAGTACGGATCTGAAGGATCCTTCAGGATCGCCGATC
CACTACGCGCACTAAGCGCCTGCTTCGTGTCCTCCAGGACTGTTTCGTCCATAAGGGACGACGAGTTTAACTCATCTTCAGGTCGTATAATAGCGACCTC
GGCTAATTCGCCCGCCTTTAAGGCCTCGCCGAACTCGGCAATTGACATTTCGTCCAGCTCTAGCAGAACATCTGCGGCGGGAACAGCCTCAAGGCTAACG
TCGCCAGCGACCTCGCCGGTCACTCCATTAACGAGTGTATATAGCTGTTCGCTATCCACCACCCCCGACACTTGCTGTGTCATAACAGACGCTTTGCGTC
TCGCAGCTGCCACACGGCGTCGCTGCCGTCTCCTCGCGGAGACCATACGCCTCGGGGAGGCCTGCATATTCACACCAAAGGTGTCCTCAGGTGTTTCCAT
CTCTTGTTGCTTCATCGGAGCGTCGACGTCAAACTCGACATCCGGCGAGGAGCTGCATAGCTCGCAGTCCCCACCCAGTGGGTTATGTGCCACTCCACAC
GCATCGTTAGGGCTGGGCCCAGGATGCCTCGGCTCGTGGCCGACCGCGCCATCGTTGGCACGCAGCGATTCTCCGCCATCGCGGCGCTCACCGCTCAGCG
GATAACGTGCCGCTCCACGCGCATCATCAGGGCTATGCCCACGATGCCTCGGCTTTCTGCCGACCATGCCATCAACGGCCTGCAGCGATGGCTCGTTATC
ACAACGAGTCCCGCTCAGCGGATTACGTGCCGCTCCACGTACAGCC