Description :
From Genome Similarity Track
Location :
Scaffold_1881:437- 6085
Transcript NameFunction/comments
Pytar_ATCC12531fgenesh_masked-par_contig_1881-abinit-gene-0.9Calmodulin binding protein
Pytar_ATCC12531maker-par_contig_1881-fgenesh-gene-0.1Conserved gene of unknown function
Pytar_ATCC12531maker-par_contig_1881-snap-gene-0.5Ribosomal protein L26

Sequence
5648 bases(100 bases per row)
GAACCAAGTGACCGGCGTTGGCTAACGAGCCCACGTAGCATTCCCATTCCCGACCGTGCACCGTTGCTTCCAAGCGATTGGGAGGCGAGGTCTCCCGACG
CCACACTGAGTACCGCGGCCAAGAAACGGGCGGCGTCGTGGGTGATGACCGCGGAGACGATGCGGGCCAAACGACGCACCTACCAGAACATGCACGAAAT
TGTCAAGCTCGCCAAAAAGTACTCGCCCAAGCTCGTGAAAGGATACAGCGCCGGCAACATCTCGGTCGTCGACAAGAAGAGCTGGCTCGAAGTCTGCGAC
CGTAAGCACCGGTGCGTCGAGTGTTTTCTCTCGTTTGCATGTTGCTGGATATTGGACTGACTGAATATGATCACCATAGTTATGGTGCGAACTTGCGCGC
ATACTATAAGGAGTGGAAGCGACAGGAAGCTAAGCCGAGCTTTTGGGAGTGGCTGGACGACGAGACAGTGGAGGTCGAGGGTGTGCCGCGCACCAAGCTC
GAGCGCGAGACTGTGCTCTATTGTGACACGGACGCCGAGCGTCAGAAGTTCGCGCTCACGATCCGCAATGGCCTCGTGTATCACGAAGAGTCCCAGGAGA
TTGTTCAGAGCGGTGACGACGGCTGGATTTTCGTGCTTCGCGATGGAATCCTATTTGGCAGCCAGAAAGAGACCAAAAAGATTCCACGTATTCACCACAC
GAGCTTTGTCGCGGGTGAGTGCGTGCAGACGGCCGGTATGATGGTGATCAATGACGGCGTGATCCATACGATTTACCCGCATAGTGGCCACTACCGACCG
TCCGAGCACGAGTTGCTCGTGCTGCTCCGCTTCTTGGTCGCGCAAGGCGTCGACCTCTCGGAGATCCAGGTCGACGTGCAGCGCATCCAGAAGGTCTTTC
GTGACACGATCAACGGCGCGCTCGTGAAAAAGATCGACAATGCCCACTTTTGGAACGCGTTCGATGTGCTTCACTTTCTCGAGGAGAAGCATCTCGCGTG
GAAGATTGGCATGTTTGACGAACTCGTGGACACGGTCGTCCGGAAGAACTATGTCGGGCTCGAGGTCGGCGACTTGGCCGACGAGGCTATGGTGGACGAG
TGTGACACGACCGCGGACTTTACCTTTGAGACTGCTGGCAGTGGTGACAACAATGTTGGCGGGGGTTCCCACCCGTCCACATTTGAGCGCTCGTGCGACA
CCATTTTTGAAGATCCTCTGGATCTGCTCGCGACCTGCGAGCTGCAGCATTAGGCTGCGACCACACAAGAAGAAGATGAAAGATGAGAGACGAAGAAGAC
GAAGCACATGAAGAAGATGAAGATGAAGAAGCCAAGCAAGTGTACTCTAATATTTGCAAGTACTCAAGGATACCAAACCAAGACAACGTTAAGTCGATCG
CCCCTCCCAGAGAAAACGATCGCCGCCTGTACCATGATCACCAAACCATCCCAAGGACACGAGTGGCCAGTCCCAGTGCGTCGGGCCTAGACCCCATGGT
GTGCGTCACGCACCCCCGTAATGTAGTAGCAGTCTATTTAAGCCACTCGCCGACTCCTTTACCCATAACATAGCCTCCCTCCTCCATCTTCCTCTCTCCT
TTGCTCAGTGACTGTCGAGCCAAACATAAGAATAGAGAAACCTACAGCAGCATGAAGAGTCGTCCGTTCCATCTGCGCGAGATCGACGAGGCGACTTCAC
TTCTCGTCCTCATCCCTCGATGGCGTCTGGTCCTCCGGCGGCCGTCGTGCTGGGTCCTCTCCACGTCTCGTGCTTTGTCACCGCCGCGAACCGCGCGACG
CCAGTCTTTGATGTGCAACCCGACCGCAAATGCGTACGCGTCGTGACCAAGGCGACGCCCCACGCCATCCACTGCGACACTTCGCTAGGAGCCTCCGGCG
TGACGGCAACGACACCGACGACGACTGGTGGCAGTCTCCCGATCGCCGAAACCCCCAGTGTCGAGTGGGACTTCCACGCAGTGTTTGCAGCGGCGACCCA
CAGCACCACATTCTTCCGCGACGTCACGCAGCCCGCACTTCGCAGCGTCGTCGTCGACGGCGTCAACTCCAACGTCGTGGCCACGGGCATCCACCCGACC
CAGAAATTCCGCTTTCTATTTGGCAAGTCGGCCTCCACGGCCGCGGCGCTGTCCGCAGCTGCCCCACCACGATCCCTCGACGAGAAGGATGTGCTGGATC
TCCACGGGCAGCTCGGCGGACTACTCTTTGAATTCTTCTATCGCATCGTCAACCAGCCCGAGCAGCTTCATGACTGGGCGATAGGCATCAGCTCGTGGAT
TCTCGTGAACAACCAGGCTGTGGACTTGCTGCAAACGGAGAAGGGGGGCGGTAGCAATGGCTCGTCGCTTTCGTTCACGTCCATTGAGGCAGTGAGCTTT
GCGAGTGCACTCCAGACGCTACAGACGGCCAAGACCCACCGCATCGTGCGCAAGCACACGGCTGAGCACTCCCACTTCTTTGTGCGGCTTGCGTTTTACC
ACAGACCCACGGGGCAGCTCAGCACGCTCCACGTCGTGGACCTCATGGACCTCAAGGACTTTGGGGACGACACCGTGTCCAAGCAGGAAAAGCTCGAGTT
CTACGACATTCTCCACGAGATTCGTCAGCAAACGCACGCCATGGCAACGAGGACGCCAAGCGTCCACTCGCCCAAGCCCAAGCCAAGTACGTCCGGTAAG
AAGACGATGCTGCTGTCAAATTTTCTGCAGCCGCTGCTCACGCAAAACGCCCAAACGTTTCTCTACGTCAACGTCATTGACTCGCGCGCGAGTCTCCGCG
AATCCGTCGCGCTGCTCAATGCCGTCGCGAATGTTAAGGGCTATGCCTGTGTGTGCAGGCGGCTCAAGGGCATCACGTTCGAGCAGCTCGGCTTCCAGCC
GCCGGCGCCACCGGCACCGGTGGAGTCCGTCGAGTCGGCGTCTTTGGACTCGGCTGCCGCGAAGGCCATGGCGGCCGTGGCTATTGGCGAGTCACTGCTC
CATCGTCTGTCGTCTGGGACCGCATCCGTCTCGCCAATGGAGAAGCCCAGCGCGTCTCCGGTCGTGACCTCGGACACGCTATCGTGGCTCGAAGCCTTCA
AGCAGCGTAAGCAGGAGATCCTCGCGAGTACTATGTCCGCACCCATCGCGCCTATGCCAACGACCCACCCACCAGCGTCGGTGGACGAGCTGCCTCTCGG
CCTCACTGACTTGAATTCTTCATGGATGCCGGCACCTGCGCCATCCACGAGAAGCTTCATAGTCGCTCCTGCTGCTGGCACGAGCAGCGATCTGTATACG
CGACTGATGGAGACCATCGAGCAGGCGACGCCGTCTCCTGGTGCCATGACTACGCCAACGATTGCGTCTCTGCGGACGCAGCTTCGAAGGTCCAGCTCGA
TGCCGCTGCCCATCGAGGACGACCCCGCGGACAACATGAGCCCGCACCCTCCACCGCGTCCGCATCCCTCGATCTCTCAGACGCTCGCGTCTCGGCTCGC
AGAGACCATCGGCGGTGGGACGAGTCCACACGGCCAGTTGCCTTCTGTCCAACCACCACTCGGCACCAGGGCGGCACCACTACTGCCGTCAATGGAGCTG
CCCTGCCAGGTCATGACGCCGCCTAATGTCACTGGCCTGGACGCCGCCACAGCCGCCAAGATCCAGGCCACGGACGCCGCGCTGCTCCGAAAGAACTACG
ACGCCCTGCTTTCGGTCGTGCGCGAGCAGCAGCAGCTGCGCGAGGCCGCCGAGACGCGCGCCAGCGAGATCGTCCACGACTATGAGGAGCGACGTGCGCA
GTACGAAGTCCACACTGAGAACCTCAAGCTCGAGGCGGTCGCGCTCAAGTCGAAAGTGCGCCAGCTCGAGAAGCAGAGTGGCGTGGGCCACGTCTTTGAC
CAGTACGAACGCGAGCTGGAGAGTCTCCAGCGCGAGCTGCAGCAGCTCCGCATGCAAAACGTCGAGCTCGAGCTGCGGCTCGCGTCCACAACGAGTGGCG
AGGCCGTCGCCTCCTTCACCAGCGGCTCGATGACCGAGCTGAAGAAGCGGTACCAGGCCATGGCCCACGACAAGCTCGAGCTCGAGCGGNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNCACGAACTGCGCAAGAAAGAGCGCCAGTTCCACGCGCAGAGCAAGCTCATTTACGAGTCGACGCGGAAAGTGGATCGG
CTCTCGAGGTGAGACGCTGGATATCTGACTGGGTTGTGGGGAGGTTATCTAATGGTGTCTTGGGCTTTCTGGTCTGCTATAGAGAGTTGGCGGCACGCGA
CGGCGCGCTCCTATCGACGCGGCTCAATAAGCAGCGGCTCAGTGCCGAGGTCTCGCGCGCGCAGCATGAGACTGAGCAGCTCCAGCAGGAAAACGAGCGG
CTCCTCGTGGAAAAGGCCGCAACGACCGAGGAGCTGCTCGCGTCGAAAATGTACTTGGCGTCGGTCGAGAGCGAGCAAAAGAGAGCCGAGATCCTCGACA
AGTTTGTCCGCAAGCACGGCGACCGCATGCAGCGGCTGAGGGGAAGAGAGAGCAGTAATAATATCGAGCCCGAGACGTGGCGGCGCGACGCCGCGGCGCG
CGAGACCGAGGATAGGCTGTTCCAGGGCGTGAAGCGCAGCGTGCCGCAGCTCGTGCCGCTCGCGACCAAAGTGCTGCGCAAGCTCGAGACGCAGGAGCTG
TCGCTGCGCGAGTTTGCCGAGCGTGAGGTCGACCTCATCCAGTTGCTCGTCGAGCTCGCGAGCGATCAGCCAGCGGAGGCCCTCAAGACGATGATCCACG
ACGAGCTGCAGAAGCTCTCGCTGGGGTAGAATAGTAATACTGCAGTCGTAGTATGATTGGGTGGCTCATCCAGTAGTGCGTGTATTGGTGAGGTATTAGT
CCAACGGTGTGGAAGACGAGCGAGGCAGAGCCGCTTAGTCGACGTTGGCCATGGCGACGTCGGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNT
GAACTTGCCCTTGTTGGCGTCCGCGACCGAGCGGTTCTTGCGCTCCAAGATCTTCTTGCGGTCCTTGTCGAGCTTGAGCTTGGTGATGACGACCTTGGAG
GCGTCAATGCCGACCGGCACGGCGGCGCCGTTGGCCTTTTCGCGGACGACGCGCTCCACGTGGATCACGAACTTCTTACGGTACACGGTCGTGACGCGGC
CCTCACGGTTCTTGTAGCCGCCACGCACGATCGTGACTTCGTCATCCTTGCGGATCGGAAGCGAGCGCACCTAAGTAATTAGATAAAGAGTCAGCGACCC
GTCCACGGGACAAGGTGAGCCGAACGCATGCCGACGGGCGGCTCCGTATCCACATGCACAAAGGGATGCGTCTTGGAACCACCATGTCAGCACGGTCATT
CAGTGGGGAGGAGGGTAGATGACGGGACACTCCACAGTCTCCTCACGGGGGCTCGCCATGAAGTCGCTCCTCGACGAGCCGCCGTGAGGAACCGTACGCA
CTGGATCCGCACTTACGGTTCATACGATGCCATGAAGTGCCAGCGTGGACCGGGGCGCTTCTCTCCAAAGAGAGAGCGCGCGCCCCGCACTGACATGGAC
TTATACGTTTGAAGTGTAGTGGGCGTCTGCCCTCGCGGGCTGGCTCGC