Description :
From Genome Similarity Track
Location :
Scaffold_423:4368- 5873
Sequence
1505 bases(100 bases per row)
GTAGTACGGCTCGTCCTGGTACTCTTCATAGCAGTACGGGAATGTCGCCGAGCTCGAGTCCGGGTTGAACAGGTTCTTGCCAGCGTAGATCATGACGTAG
ACGCCGGCGAGGAAGCAGACGATAATGATCACAAGCGAGATGACCTTCTCGTACAGCGGGATCTTGGTCCACAGCACCTTCAGGTAGAACACGAGCGGGA
CGAGGAGGCTGCACGTGGTGATGAACGTGGCACCCGTGAAGTCGACCAGATCGAGGAAGTGATCCCGCAGAAGGATCGAGAGGACGGCCAGGGCCGCGAC
AAGCGCGATACGCACGCCGACGTAGCGAATGACGTTGCGCGTTCCCTGGTACTCGGCGCTGTCCTCCGTCTCGTCTTCGGCCAACGTGACGCGGCTCGTC
CGGTCATCGGCCGTGTCGACACCCTGCGAGTTGCTCTCGAGGTCGGTGCTGTTGACTCCCTCCGACGGCGTCTGCAGCTGGTTGTACGAGATCTTCTCCT
CGAGCTCGTTGGTCTCCTCGTTAGCAATCGCCGGGTTGACCTTGTGCATGCCGAGCACCAGACGCTCGAGCATGTAGAACGGCGGCTGCAGGATGGTGCA
GAAGGCGATCGTCAAGTGCATCTGCATGAAGAGGAACGACATGATGACGGCGCCGCGGTCGGCAATGAAGCCGAGCGTCGTGGCCGCCGAAGGGTCCGAC
GTGTTGGTGATCGAGAGCAGGATGTTTCCCGAGATCTGGCAGCCGCCGGCCGTGTAGCCGACGATGGCGAGCAGCAGGAAGAAGACAGAGACGAGGCCCA
GACTCACAACGATGACGCGGGGCATGTGGCGCGGGTTCGAGTGCTGGCGCTGGAGGTCCGGCACGACGATAGCGGCAGCGTACGCGAGCGAGAGGTTGCC
AAAGCTCATGACCACTTGGTGCGCCGTGACGTCAGACGACGGGATGCTCGGGTGGCCGCGCATCTGGTACAGCAGCACCGCAACCGCAATGATGTCGGCG
ATGATCGTTCCGAGGCAGCCCGCGAGAGCCATGCCGGCGCCTTCCTTGAGCGTCGGGATCACGGCAACGGGGATGACCATGACGGCCATGAAGATAATCC
AGACCGTCTGGCTGAACGAGTCGGGGAACAGCACGTCCAGCAGCGTGCCGCCGAGGACGAGGAAAGCGCACGGAGCCAGAAGACACACACCCATGTGCGA
AATCACAACGATGAGGCGGCCGAACTTGCCCATGACCCAGTCGCCCAGGTCGCCGTACGTCTTGACGGTGGACGGAGCGACGAGCATCACCTTGGACAGC
GCGACGGTCGCGTAGATGTTGGCCGAGGCCATGAAGACGATGGCGATGGTGGCGAAGACCGGGCCGGCACGCGCGTAGTTGGCAGGCATCCCGAGCGAGC
CGATACCGCAGACCGTGCAGAAGATGTTGAAGGCAGCCTTGGAGTCTTCGAGCGTGAACCACGCAGAGCGCGACGGGGTCGCACCATTGGAGGCCGTCAT
GGTCG