Description :
From Genome Similarity Track
Location :
scaffold_40:43677- 48396
Transcript NameFunction/comments
Plaha_PHALS_07181major facilitator superfamily
Plaha_PHALS_07182Zn-ribbon-containing protein implicated in mitosis
Plaha_PHALS_07183Ribonuclease H2%2C subunit C
Plaha_PHALS_07184hypothetical protein

Sequence
4719 bases(100 bases per row)
ACCGTATCCCGTCATATATTAATTACATAAAAACTACGGTGGCCAACTTGTGTTTCAAATGGCAAtaaaaatggacgatgtaaaCGAGAAGCTTTTACCA
ACTGCACAGCGCCCACAGGTAGATGATGGTAGTAGGCATGCATTGAGTGGAAACATTGTATCTTTTATGGGCTGCATTCAACCGAGTCGGCTGCGACTAG
CAGCTTGGCTGATCTCCATCTCGTCGTTCATGTGGGGATTTAGTGCCACCGTGCTGAACGTATGTATTGTTCCGGACGCAGTGGGCTCTATACTAATTGA
CATTAATCTCGATACAAAGGAGCAAGAGCTCGCAACGGCACTTGTGGTGGTAGGTTGTGTGCTGTCTGCGGTCATCTCAGGCGGTGTTGGAGCGCGCATA
GGTCAAAAGAAAACCATACTTATCAACAATATTTTGTATGTTATTGGTGGTGCCTTATGTGCGCTCGCAACTTCTAAACGCGAGCTATATGCCGGTCGAG
TTATCACTGGACTGGCATCGGGTGTTGTGACCAACACGGTCCCCATTTTGCTCAAGGAGATATCGCCCACTGTATCTAGTGGAGAGATAACGTCACTTCA
TCAGCTAAGTCTAACGATTGGCATGCTAGTATCAGCTGTACTGGGCTGTATCATTATATCCAAGGTGCCCTCAGGTTGGCGATATCTTAATGGATTTATG
ATCTTGCCACCGTTAATACAGTGCATCAGCGCGTCTTCAATGCCTGAAAGTCCGTGGTGGCTAATGAAGAATTGTGGTCGTGAAGACTGCCGAGCGACAC
TAACATTTCTGCGCTCAGACTATCAAAAAGGCAATATTGAAGCAGAGGTGGTGGAAATCGCACGTGTAATGGAGCATCGGAAGCACGAACCTCACGTCAC
CTGGTCACATCTTCTGATGCACAAAAGAGTCATGATCACCGGCACTATCCTCGTTTTTTTTCAGGCTATGACGGGCATTAATACGGTGATGCTGTACTCG
GCCAAGATTTTCGGTTTCGCGGGAGTGTCCAACCCGTTTCTTGCCACGATTGTTGTAGGCCTTACCAATGTTGGCGTCACTATATTAACAACGCGCCTTG
TTGACTCGTATGGACGCCGTCCGCTTCTCATTGTGGGAACGAGTATAATGACGTTTGCACTTGGAGTACTTAGCTGGTCACTACTTTGCCTCGACAGCAA
TCTTGGATTTCAGGGCATAATTGCGGTGATGTCAGTGCTTTCATTTGttagcggctttgccgtTGGTCTGGGCGCTGTCGTGTGGTAAGCATTTGAAGTT
ATCGTTTTTACTAAGTGTGTTCACGTCACCAAATGTTGCCTAAAGGGTCATCCTGGGTGACATTACGCCAGTGCACATTCGCCCGAGAGCGTTTGCTTTC
TTTATGGTCGTATCTTATCTTTGCAATTTACTAATTGCGGTGTTCACACTGTCTGCCATTAGCTTTTTAGGACGCGGGGTCAACCCTGAAAAGAATGGTA
TCGCCAAGCTCTATTTGATTCTAAGGTTTGCTTACACGGAACCAACATCTCGTTTCGATTCTAAACACGAACTGATTCAGACTCTGCTCAACTTTTTTTG
CCCCGTAGTGGCGTTGCTGCTGTATGCCTTGCATACGTTTACTTTTTTGTTGGTGAAACGCTGCACTTAAACTCGAATTTAGTGATTGTTGCTGATGATC
AAAAGTCACTTCTGACGGAGAAAGCAAACGAGGTTCCCCGCCAAACGACTACACTTTAAAGTATATCGAACAAAGAATTGTTTACTACGTTCAAAGGAGG
AGGCTGGATTACATTTGATATGAAAACTACTCCTTTAAAAGatgggcagcttcagcaaTCTCTCGCAGGGCTTTTGAAACGGATATGAGACGCTCACAGT
GGTCGTTGGGCGAAAGAGCATCGGTGAGGACAACCATTTTCTGCGTATATATGCAACAACAACATACATTGCAATGCGTTAGTAAATCCACAGTGTTCTT
TATAGTGCACAACGCCATGATGAAATGGATTGCTCGGCTTGTACATAATCATGCGAAGATCGGATCAGGAATCCATGTGATCTGCCCCACAACTCTTGTA
ACGTGCAGCCACAGAAGTAATCACATATATAACCGGCTGTAAACTAGAAAAAATGCGGATGCTCAACCTCATAAAGCGCAGCGAGGGTCTGACGACGGAT
GGTATTCACTTCTACATCGCTGTTGGGGCTCAATGTGGTGACATTCTTGCGCTTTACTATAAAAGTGTGAAGATTAGTAATTTGATGCCGAAGCAACCAC
AACAATGGAAAGCAGCATAGTACTCTACCAGCACCCTTTAAATTTATCGCTTggtgattatgagcttgctctagCGTCAGCATCTGTTTCGCCTGTCTGG
CTTGTTCCTCTAAATGGAACCGCTGCTCGATGCGATGTCGACGCTCTTCCTCTTGGTAAGGTTCATTCGCTGCTTCTTTCTTGACAACCCTACTATCCTC
TTCCGCTTTCTGTTCCGCTTGCTTGATCGCTTCCTCCTCTGATATGACAAACTGATCGCAACGTGCGCAGAGCATCTTTGAACAACATAACAATTACGAT
CAAGTCAAAGCGAAAGAGTGGATTCAAGCGGCGCTTGCCTTTCCTTGCTTATTACGCAGTAGTGGCGTGTAGCAGTCTTCTACAGGGCAGCTTGCACCCA
ACATCGTCCAACCCTATGAGCAGTTCAAGAAATTTTCAGCGTGAAATTAACTGGTAGAATGAGGAAAAATTATCCAGCTGAAGTTGGAAAGCACTGCCTG
CCATCAACGCGACCAACCTGCAACATCTTTTCTCCCAGAACTCGACTAGCTTCATCGCGCGAGCGCTTAATCGGTGCAACGGCCTGTTTTTATAGATAAG
TAGAGATCGTTAGCGTCAAGAGATAAAGTTACCCTTCAGTCGACATACCGTTTCCATGATTTGAATTTGCGAAGGAAATCCTCAAATCCTGTCAAAATTC
ATACCGGTTTTGATAAGAATACTCTTCCAGCTTGATCAATTTACCAGATGGCAGAAAGCACATCATCTACTGTTCGCGTGTGTCTGACACGCTGTCCACT
GCCAACAGCGGCAAATGACGTTCACTCGTTGCCATGCCGCATTCACTTTGACGGGCCGGCGGCAGTCAAGACCTTCTTTCGACCCCAAAATGGCAAAAGA
AATAGCAACAGCACAGATCATGGTGGTCTATGCTCCGAGGAGCAGGATACCATCATAGAATCAGAGCAGATGGACGACAATAGCAAGAAACTCTATGCAG
ATTTCCGTGGAATTAGATTGGAGGGAGAGAAGCTGTCGTTGGCAACTCTGGGCTGCACCGGTACATAAATTGAAAAAATACGCTGGGGGATGTGTACTGA
TGACGTAACGTAGGCGTCGTCTTAGAAGATTGTGGCATGCGACACCCGGATGATGAAGGACGTATCTGGGAAGTCGACGATCATTTTGATGAGATAACGT
GGTGGTAGGTGGCGCGTTGGAATTTTCTCGTTGAACAATGACGATCACACATTTTGTGGCTTAGGGACGTGCCGAACCACACAACTAGCGACAATCAGCA
GCTTCCACTTGTGCTGCAGCAATGGTGCAAGTTAGCCTCCGCGGTACGTGCATATATCACTTTATTTATCCTTCACGCCGACACTTGTGTTGTAAACGTT
TTGATAACATGCAATCGTGTGTTTTGTGGTTGGAAGATTCACGGATAATAGCTCATAACGCTTAGGGCATCGTCAGAATGAAAAACATCACGATGTAGAT
ATATTAATATTAAACTCGTAATCATCTGCTAGCAACTTGTCGACACAGCTAGTGTCAGAATATCATTCGAACACTTCCGGCGTGATCGGCTGGGAGGCTA
TGCAACCACTCACACAAAAGCTATTTCAATTCGGCCTCTTAACATGTCGATGCGAGTGCGGCTTGGTTGTGCCTTAACATTGTTAGTGCTGTTACCTGTG
GTAGCGCTAAGTCTTTGCGTTCCTGGGATACGTTGGATGGAGGCGCCACAACTTGAGCGCTTGGCGAAGTGGCGCGCACAGCATTAGGCCATGATACTTG
CATTGCAACTCAGAGTGATGCCTTTAAGCTCCTTGACACGCAGTCCGAGGAAAAAGAAACAGGTAAGGCAAAGAACACCGGCAATGGCTATGATTTGGAT
AGAAAAGGTGATGACATTCACGACCTATAGCccttgaagaagcagaggtCCGGGTCTGGAGAAAAGAATACACAAGATCAGGAAAGGAAGGAGAATGAGT
AGGATGATCAATTTCAGGAGGATGGCGATGAGGAGAATGCGCAGGATACCATAGCATTCGCGAAGCTTCGCCCTCGAAGGCGCGTTTTCATTTGGGACTT
GGACAAAACTTTGGTCTTATTTGCCTTACTGTACACGAGAAGATTTGCCCAGATGCATGATAAAGAGGTGGAACCTGGAGTTGTTATAGGTGAGCAGATG
ATGACATTTTTGCTTGCAATGCTAATATTGACACAGACGTTGACCACATCATTGTACCTTTCGATAGCGAAGGTGAAATCGTGAGTCAATGCGAGACGCT
CCACCAGCCTACTCTTGAAGAAAGATTTGAGCGAATTTGTGACATATCTGAGCGTAGCGGGGAGGATTTCTCGCATGACACAAGTAGCGAATGGTTTCAG
ATTCGTGATGCGCTAGTGG