Description :
From Genome Similarity Track
Location :
contig_13:436727- 437993
Transcript NameFunction/comments
g2443.t1hypothetical protein PHYSODRAFT_478999

Sequence
1266 bases(100 bases per row)
GGCGAGGTCTTCTGCGGTCTCACCACGCAGGACTCCGGGTACGTCAAACTGCCCAACAAGGTCGACGACCACTACTTCTACTGGTACTTCGAGTCCCGCA
GCCAGCCCAGCACCGACCCACTCGTGCTTTGGCTCACGGGAGGGCCAGGATGCTCCAGTATGATGGCGCTGCTCACCGAGAACGGACCGTGCCACGTGCA
GCCCGACCTGTCCACGAAACTCAACCCGTACTCGTGGACGAACGAGAGCAACGTCGTGTGGCTGGACCAGCCCACGACGGTGGGCTTCACGTATGGAGAC
GAGCAGGACGCGGACAGCGGTGAGGACAACGTGGGCGAGAACATCTATTACTTCCTGCAAGGTTTCTTCGAGAAGCACCCGGAACTGGCGGGCCGTGACT
TCTACATCACGGGTGAGAGCTACGGGGACACTACGTGCCTGTGGCGGCGCACTATGTGTGGAAGAAAAACAAAGTGAATGTTGGCACGTCAGCCTTCATC
AACTGAAGGGCATGCTATCGGAAACGGACTTACCCAGGCGCTATTCAGATGCCTCACTACATCGACATGGCGATTGAGAACGCGTACAACATTTCGCTCG
TCGGCATGAAGCAGCTGGACGACATGAAGACGGCAGTGCCAACGTGCATTTCTCTATTGGAGCAGTGCCCGCAGAACGTCACGGCATGCGTGGATGGTGA
GAGCTTTTGCATGGAGAAACTTTTCGAGCCGCTGTTGTCGAGTGGCCGTAACCCGTACGACATTCGTCTGTCTTGCAAAGACCCGAACGACGACACGAGT
TGCTATGACATGTCGTACGTTTCCAAGTACTTGGATGCTCCGAATGTGCGCGCAGTGCTGGGAGTGGACTCGAAGCGTGTGGGCGCCTGGCAGGAGTGCA
ACTCGCAGGTGTACGAAGCATTCGACAAGACTGCTGACCCGGCCAAACCATACAACTCGTATGTGGCTGAGCTGCTGAATAGCGGTGTGCGCGTGCTTAT
CTACGCGGGTGATGCCGATCTCGTGTGCAACTGGTACGGCAACGAGGCTTGGACCCGCGCACTGCAGTGGAAGGACCGGGACGGGTTTAACGCGGCGCCC
GAGACCGCTTTCTTCACGACTAACGGCACCAACGCGGGTGTGGTGCGGTCGTTCAACAACCAGTTCACATTTCTGCGCGTGTTCAACTCGGGTCACATGG
TTCCGCAAGACCAGCCAGCGGTGGCGCTCGAGATGCTCAACAAGTTCCTGAAGAACGAGGCCTTCT