Description :
From Genome Similarity Track
Location :
contig_44:436666- 437936
Transcript NameFunction/comments
g9400.t1hypothetical protein

Sequence
1270 bases(100 bases per row)
CGGCGAATTTCTTGAAGAGGATCGTCAACAGCTTGTGCCTTCTTTGGCCGCCGCTTTCCCTTTGAAGACGAACCTTGAATGCTTTTTCCTTGAGAAAAGT
AATCGTGAGTATATTATGTTCTTTCTCTCTAGGCTTCGCAGTGAGGGGGCAGTAAACTGAGGACTTCAGTGTGAATTGCGTAATAAGAAGTTTGAGTTTG
GATGAGTCTCTGATTGCGACGGAGAAAGATTACGAGATGCTGCTCGATACCTCGTCAGTTAATCGTACACAGAGATGTTTCGCAGGCTACACGCAGTGCT
GTCCAGCATATTATGTACAGCGCGGGATATCTAATACTGCAGCTTCTTGCTCGTGTTGCGGAGACATGATGAAGATGGAATGAGAACAAAGTTGCCTAAT
CTCGTTCGTGACGACAGCATGTATTGAGGTGGCTTGTTGGTGGCAAACCATCTGGACTACATAAGAGATCACGCTACTTTTACTAACAAGACGGCGCCGT
AATAGTAGCAATCCATAATTTATAAATCTGCCAGGTTGTGTGCTGTTCGAGTTTCTGTTAGTAGACTTTAGTTCGCATTTTTCTTTCGACTTCCCAAATC
GCGCTATTATCAGTCCTCACGATTCCAACGAAAGAGACTATTGACGCTTTCCAAGGAAGTATGCGGCATGGGCATTCTGCTGCTGATTGCTGCGATCGCG
CTTGTCGATCGTTCCCACCGCCTTGGCAGTGTCAAATAGTGTTTTTGCACCCCCGGTTGAAACCGAGAAAGCAGGCATTGGACTTCAGAGGTTCCAACGC
ACTCTCGAAGTGATTGCTATGAATGAAGATGCCTACAAAGAAGAGAGAGATTTGAATTTTGGATGGCCGAAGAACCTGAAGCAGAATGTCCTTGGCACAT
CCGCAAAGAAGGCGGCTAAAGAGGCAGCGAAGAAGGCACAACTCCAAGTAGCCGTGGCGAAGGCGATGGGGAACGAGAAAATGCTCACGAAGATGCCAAG
CAACGATGAATACATCTTCCGAGCGTTTAAGAAATGGCACTTTAAGACGGGGTATTTGTCAAACAAGTCGTGGCGATGACTACAAAACTGCAATTCCATC
CCATTGCTGATCGTACCGAGTGTATGTACAAGATATTGCTGAAGGTTCTAAAGACGTTTGAGCTTAAGATACAGCCGCAGCAGCAGCGTAGTTTTGAAAC
GTGAATATTATAGTCATTCCCTCAGCTAGGATAGATACTACAGTACTTCTTTGTGCTCGCCTTGAAGTTG