Description :
From Genome Similarity Track
Location :
Scaffold_402:4365- 5919
Transcript NameFunction/comments
Hyaar_Emoy2814046hypothetical protein
Hyaar_Emoy2814047endoglucanase

Sequence
1554 bases(100 bases per row)
TTCCAGGAGGAGGTGCAGCAGTGGAGTTGACCACGAAAGCTGAAAGCGCCATTCCGATGATGAAGAAATTCGCGGCTGATGTGACGAACGTTGGTGTCGA
CATTGCTACAGACGTGATAAAGNNNNNNNNNNTAGTCCTGAGGAGGGAAATTCACTTCCAGGGGTGGTCAGCAGGGGGCGACCACGTAAGAGGAAAGCGC
CATTCCTGTGGGAAGAATTCGCGGCGGATGGACGAACGTAGTGTCGACATTGCTACAGACGTGATAAAGAAGAAGTTGTCGGTTATTGGCCACATACGCA
AGGTATTCGACTTGATTTGGAAGTGGCTACAGAAGATCCCCGGGTTTGACTGATTCAAGGCATGGATTATTCAGAATATGGGCTACAAACCGGTGGTTGT
GGAGACTGAGTAGCCTACGACCACGGCCGGGCAACCCAACCCCGTGAAAGAGGAGGGAACGGCAACAGCGAATGGCTAAGCGTACACCTCGCATGATGCT
AAGCCGGAACCCAACGTCGGACACACCACGCATGATGCCGAGTCACCGGTGATCCCCGTAACTCATGTCGAGATTGGCGACCAGCCAAATGTGAACCATA
ACTATCCAGCTTCCCCATCAGAAGAAAAATCCGAGTTCCCCTTGAGAACGGATTCAAGCCAACGGATAACACCAATGGTGTGATCGAAGGTGTCGTCAAC
CTGACGGACAACAGTGATCCCAAGAATGTTGTCAAGCTGACGGAAAATGCCAAAGGGGATCCCAAGACTGTTGTCAAGCCGACTGAAAACACCGAACGTG
ATAGTAAGACTGTTGTCAAGCTGACGGATGAAGATGATGATTTCGAGCTTGTTTCTATGGACGAGATAATAAAACATGAGGAATAGGGGCCTGTTCGTAA
ATTTGATGCCTAGCCAAAATGCGTGCACTGACTGCTGATGACTCATAACCTGTTCTAGAGCGCGTCAATTTATCGGGGACGCCGGACGAATGGCCACTTC
GACGCACTAGACACGAAGAGGATTTGAGGGAGCCTAGCGCAAAGTTGTGGAACGGGTACACGCTGGTAGAGAGGTGGGAGAACGAAGCTACCGTGTGTAA
TGGGGTGCCCCTGTTACATGATAATTACATAACGTAATTATCAGGTATGAATACTGCGTTAGGACAAACACAATATTCCCACAATATTATCCTAATAGAT
AATATTGCCTCGCCGATGTAACACAATCCTCATTGGTTGATATAGGATCGAGATCAACCAATAAAGTCTTGCCACGGCAGGAGCACGCAACGAGTGAGTG
GTGCTCAGATAGTTATAATACATGTTTGTACTTAGACATAGTTAAATGAAGTCAAATAGGGATTTATTAAAAGGATTAACTATAATAAATACAGTTCTAC
TTTTTACCTTTACTGAGTACTCTTACTCCGTACAACAATCTTCCTCTGCACGTACGTGTACGTGAGGTAGTCGGACGCACACGCCCTTGCACTGTCAGCA
GTGCAAGGTTTATTCAATAAGTTGAATAAGGTGTGCCCCGTTACACCGTGGTTA