Description :
From Genome Similarity Track
Location :
contig_47:436488- 438298
Transcript NameFunction/comments
g7907.t1actin-like protein
g7908.t1hypothetical protein PHYSODRAFT_491072

Sequence
1810 bases(100 bases per row)
ACGTGTTTTTGTTGTTATTGCAGATCGGTCCTGAGAAATTCCGCGCCCCGGAGGTGCTGTTCCGACCGGAGATTATCGGCTCGGAGGCACGTGGCGTGCA
TGAGTGCTTGGTACAGGCTATCATGAAGTCGGACCTGGACCTGCGGAAGACGCTCTTCTCGCAGATAATTCTTTCCGGTGGCTCGACGCTCTTCCCGGGC
TTTGGTGACCGCTTGCTCGCCGAGGTGCGCAAGAAAGCGCCGAAGGACATTAAAATTCGCATCTCAGCACCGCCCACGCGAATCTACTCTACATGGATCG
GTGGCTCCATTTTGGCTTCGCTTGCGACTTTCAAGAACATGTGGATCACCAAAAGCGAGTACGAGGAATACGGCGCTTCCATCCTGCACCGCAAGAATTT
GTAGGCGTTGGAGAGAAGCACAGAAGAGTATTCGCGGGCGTTGCTTCACTTCGATTCTATTGTTGTTTTGGTGTGAAGCGAGCGAGGCAACAACTTGCGG
TTGTTCTGCTGGCGTAGAGGGTTTGAAGATTGGGAGTGGTCGAGTAATACAGACGAAAAAGCTTTTTAAAATACGCGTGTCCATGGGGTTTGTACTTCTC
CTGAATAGCTATTTACACTTAGCTGTGCACTTTCGTCGTTGCGTTCTATTGCATCGATGCGATGACTACTACGGTAGCGGCTTAGTGTGAACTGTCGAGC
ATACCAGCTCGAGAAGCGCGCCGCTGGTCATCCTGCTGCCTCCGTCTCAGCACCACGACCGAAGCGGCCCAGACATTACACCCCACGCCAGCCAAACCAC
AGCAAATAGTAGCACGTCACGAAGACCAGCGTGGTCCTCCGAACAGCGCGGGTTAAGCTTCGCTTCGCCGTCGATCTCCACGGTGCCACACAGAGGAGCC
CAGGAGTCCTTGATAACACCGAGAATGATAGGGGACGGCACGTCACCTAGCGCGTGAATGATCAACGTGTTGGCCGCAACGGCCATGGACTGCCGCGATT
TGGGGAAGAGCTCAAGTACGGCAATCGTCTCGGGCACGGAAAGCGCGCACATGCAGAAGAGACACAGGGTGAGGAAGATCAGGCAGGCCATCTTGGTGCT
GGCAAACGCAACCATCACGAGCCCGAACACGACTGCAGCCAGCATGAAGTAGAACAGCGCCTTCACAGAGATCATGCAACGGCGACCAATCTCGTCCGGG
TGTTTCTTAGCGAGCCAGTCGACCAGGATACCTCCCACAGGAGTGCCAATGGTGCCAGTGATAGCAACAAGTCCGCCGAAGATGAGCGACACGGTCGTCT
CGCTTTCAAAAAGTCCCAGGCCAATGAAGATGGCAGGACTGAAGGTGCTCATGGCCGCCAGCGAGAACGTGTACGCTGCGTGTCCGAGGATGATTAGTAG
GAACGGCACGTTGCTGAAGATAGCCCACCACTCCACCATGAACGACGGCTTCGGCATGGGCAGACCGCGGTCTTTGTCCTCCAGGAACGCCGTCGAACTC
ATCTTGTCGTCGTCGGGGGTAGCCACCACTACGTCGCCTTGCTTGTTCTCCAGCTCTTCCGCGTTCGCCTCATTGGCCGGAATACGGTTCAGCTCGTCCG
GCACGATCACAAGACAGCAGACCACGAACCCGACCATAATAACACCCTCCACGTAGTACGCACCAGCCCAGCCCAGTCCGGAGCTGGCAAAGATCGACCC
GTAGATGTAGCCGACGGCCGTGCCCACCGTGATGGAAGCCAGATAAATGCCAAGATACAGCGAGCGTTTGGCCGGGGGAGCAAAGCGGTTGATAAAGGGC
GTCGCCGTGC