Description :
From Genome Similarity Track
Location :
scaffold_103:43642- 44668
Transcript NameFunction/comments
Pl_109706endo-1,3(4)-beta-glucanase, putative

Sequence
1026 bases(100 bases per row)
TGACATCCAAAGCATTTGGACCGTGTCAATAGCCGGAAGCTACTACTTCACGGGCAAGCTTGTTCAGCAGTATGCGTCGCTGTGCTTGATGGCCAACGAT
CCAGTAATTGTAGGCACGGATATCTCTCTCCTACGCCGCTGTGTTACCAAACTTGAGGATGCCATCACGCCGTTCTTGGATAATACTTGGAAGTACAAGC
TGAAGTATGATGCTATCATGGGCGGTATTGTGAGCTCGGAAGGGTTCGTCACCGGGGATATGAACGCTGACTTCGGCAACACCGTGTATAACGATCACCA
CTACCATTACGGCTACTGGGTGCACATGGCTTCGGTGATCAACTACTTACACCCGACCTGGACGCGGATTGGAGACCTAAACAACATGACTCGCCTGCTT
CTTCGTGATGTTGCCAATCCGTCGCGCAATGACCCGTATTTCCCCAAATTCCGTGGGTTCGACTGGTTCCGAGGCCACTCGTACTCGCATGGTATGACAA
CGCTAGCCGATGGCAAGGACGAGGAGTCCACATCGGAGGACATCAACTTCGCGTACAGCATGGCGTTATTCGGTCAGACGACGAACCACAAATCCATGAA
AGACATCGGTCGCCTCATGACCAAGGTCAGTGCTCGCTCGATCCAAACGTATTTCTTGTTCGACAGTTCAAACACCATTCACCCTGAAGCGTATCGACCT
CACATGGTGCCTGGGATTCTATTCGACAACAAGGCCGACTACGCAACGTGGTTCTCCGCTGATGAATACATGATCCACGGCATTCAGATGCTACCAGTGA
CTCCCGTTCTCGAGTACGTGCGAACGTCGAAGTTCGTACAGGAGGAATGGGACACTATCCTATCCAAGTTGGACATCGTGACTGCAGACCAACAGTCCAA
CTCGTGGTATTCGTTGTTGTATCTCAACTACGCACGGGTGAACAAGGCACAAGCACTGCTCAAGCTCAGCCAATGCACTTCTATGATGGACGGCCTCTCT
CGCTCCTGGGCCCTCTACATGGCTGC