Description :
From Genome Similarity Track
Location :
Scaffold_20:436414- 439287
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G007896Protein of unknown function
Pytul_DAOMBR144PYU1_G007895Similar to EAF3: Chromatin modification-related protein EAF3 (Candida glabrata)

Sequence
2873 bases(100 bases per row)
CGGCCACTCGGCGTCCATCATTAGCCACGTAGAAAAGGAAACCATCCGCATCAATCGCGAGCGGTGGGAGTCGAACGAGTACGATATGCTCTACCAGTAC
GGACTCGGCGAGGTCGCGATGCTCGATATGGACGAGGAGGACGAGGCCATGTTTCTCGGCCAACAACGTCGCGACAACAACGACCTCGCGGACGACGATG
TGATGATGCAGAGCGACGACATGATGGACGACGAGAGCTACTACTACACGCCGCGCAACGTGCTCGTCGATGCCGAAGTGCGCTTCGCCATGGAAGAGAT
GGACGCGTACGACACCCGTCAATACGAAGAGGTGTGTTAATTTGTCTCTTGTTGTGCGTGCGTGCGTGCGTGTGTGTGTGTGTGTGGAAGAGCTGCGCAT
GCCTGTGTATCGCTATTAGAGTTAGGATTGTGTGCCCAGCTGCTCTGTAAAAGCCAATGTCTTATATCTCACATCTGTGTGTATTCTTTTTGTGCTGTTG
TTGGTGTAGTTGAACGTGGACTACGCGGTGGACTGCATCCTCGGCGACGACGACGACGACTCGGACGAGAACAACGAGCTCCCATACGCCAAGGACTCGT
TCGTGTCGCCGTGCAGCTTCGCGCTCTCGGACATGATGTCGTCGTCGCCCACGGACGTGTCATCGGCCACCGAGTGCATGATCGTCTCATGCTCGTCGCG
CGGAAAAGCGTCATCTCCGACGCCTAGCGCGTCGTACTGAGAAAATCATTGTGGAGCATTTCAAGAGTGAAGTCGCTGATTATTTTTTTGATATTATTTT
GCGAATGGCGTCGCGTCAATGCGGGTATCCTGACGATTCGCGTAGACGTGTGTGATGATGACCAAGACGAGCGAGTATTATATTTAATTGTGCACAGTGG
TCTCATTTAGCCAGGGGAGTATGGCAAAGAGCACAAGCGAGAGCAAAAAGAATTTTGCCATCGTGGATTTGAGGCGTAATAATGTAATTAATGAGTATAA
CACCACCATTAAACAGCAATTTGCATCGTTTTGGTTGTAATACAAAAGATCACATGTCATTCATCAGCAGCATTCGTTGCTGGTATGTGGAGCAGCGTAA
AACAAACATCGTATACTTTCAAAGAAACTTTGAGTAGACCAGCTGGCCAGCTGGTCTAAATACGGACTATTTATGAGGGCGGCTAAATGACTTACCAAGT
AGCCTGACTTGCGTAAGCATTTATGAAATTAGAGAGTATCTGATTAGTGAACGAGCAAGTGACCTTTAAGCGCGAGAGCCTGAGTCATGACAAATAGCCA
GCCGCTCAAAGTGAAATAAGAGTGGAAAATAGCATCTACTATTGCATCAACCGTGGCCGTATGATCGAGAGTTACATTTTAACTACCTACTGCGTGCCAA
TGGATGTGCTCGCATCAAATTAAGCTATGTGGCATCTTCATACTCCCCCCAAATTACTACACTAATTCTTCGTTCTCAGGATGCTCAAGGCATGTATCGA
ATTGATGTAACGTTGAAATTCATGGCACACTTTTAATTTCTAACCCACCATCGTGATAAGTGCTTCCTTTTGGCTTGTATAGGTTCTTTACTAGGACCTT
TAGTCACGTCCATTGGTTGACCTGCATAAGAGAGAACGATATGTTTCATCATAAAATAAGGGAAGAACTGAAGTTCACTTGGCGCCAGCACGTTCGAAAT
GTACGAGTGCCGAGCCAACGACAAGTGTAAATATTTTCTGAAAACTGGGTAGATAAAAAGATGCCATGTTAAAAAAATCAACGCGATATCCCAACGAGAT
TGAGAACCATTCCGCCATCAATAGAAGTGTAACAAAGTTAACTTGCTTGATGCACTACAAAAATAACCCATATCAGGCTCCGCATGTACAACAGTCCAAC
AGTATTCCCTCATTTTGCAGAAATCAATAAGGTAGAAAGTATGTTTGATTTCAACTATGACCGTCATGAAGGCGTGTTCTTTGACTCGCATGACGACGCG
CATATGGACTAGAAAAACTGCGTAACCCAGGTCGGCTTTGCCATCAAGAAAAAGCGAGGTAATATTCGACGAACGAGTAGTGGAGTGACATCAAGATACG
ACTATGTGTGTGCTAAAGCTGGAACACATAGAAGCTACAACAAGCTTGTAGACCGATTTCGATTACTACTGGCTATCTTGAATATCTCGGCTGCTGCGGA
GCATTGCGAGTTTGTGTCTTGACAGTGCTCAAGATGAATACATAAGTTTGATTCGAACAAACGGCGTTGAAGTACACCTCGAGCCGACCCGCGTGGCGAG
GACGGACTTGGTCTTCTTCTTGGTGTCCTCTATGGCCTGCTTCTGCAGCACGCGGTTCGCGGCCGTGTCCTCGAGCACGCGGTGGTACGCGACCCACCCG
TCCCATTTTTTGTGCCACTCTTGGTAGTGCACGTAGTACTGCGTCCTGGTCATGCCCTTAGCACCCTTGCTGTTCTCGTCCTGCACGTCGCTGCCGTGGT
CGATCTTGAGCACCTAAGCGTCGTAGGTCATCACCGTGTTGTCGACCTTGATCGGCATCGTTTCTCCCTGCAGGCAGCTAGTTAATTTGTAGCGATACGG
CTCGGCGTGCGCCGTGTGCTTCTTAGACCCTGGGGATCTTAGTTCAAACCCATCATGTCCATCCGATCAATTGACAGCGATGACGGTCGTCCCGCAGCTC
GTGGCTTTGACCGGAACGCTGTATTATGCAGCATGGATTATCCTTAATAATAGAGAGAGAGAGAAGGTCATTCTATTTAACTTATGATCTACATATAGTT
TAAGAATTCCAGAGTCTCATTAACACTGCTGAGAGTGAGGTGTTTCTAAGTTTTGACGGTGTGGCATCGACGT